Fanconi anemia genes are highly expressed in primitive CD34+hematopoietic cells

Aubé, Michel; Lafrance, Matthieu; Brodeur, Isabelle; Delisle, Marie‐Chantal; Carreau, Madeleine

doi:10.1186/1471-2326-3-1

Cited by 8 publications

(6 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1D, lanes 1, 2). Collectively, these data indicated that Fancd2 is expressed in hematopoietic tissues including a population of bone marrow which contains HSCs, in keeping with previous studies indicating that FA genes are expressed in bone marrow in Lin- cells, CD34− cells and in CD34+ stem cells [36]. …”

Section: Resultssupporting

confidence: 89%

Hematopoietic Stem Cell Defects in Mice with Deficiency of Fancd2 or Usp1

et al. 2010

View full text Add to dashboard Cite

Fanconi anemia (FA) is a human genetic disease characterized by a DNA repair defect and progressive bone marrow failure. Central events in the FA pathway are the monoubiquitination of the Fancd2 protein and the removal of ubiquitin by the deubiquitinating enzyme, Usp1. Here, we have investigated the role of Fancd2 and Usp1 in the maintenance and function of murine hematopoietic stem cells (HSCs). Bone marrow from Fancd22/2 mice and Usp12/2 mice exhibited marked hematopoietic defects. A decreased frequency of the HSC populations including Lin-Sca-11Kit1 cells and cells enriched for dormant HSCs expressing signaling lymphocyte activation molecule (SLAM) markers, was observed in the bone marrow of Fancd2-deficient mice. In addition, bone marrow from Fancd22/2 mice contained significantly reduced frequencies of late-developing cobblestone area-forming cell activity in vitro compared to the bone marrow from wild-type mice. Furthermore, Fancd2-deficient and Usp1-deficient bone marrow had defective long-term in vivo repopulating ability. Collectively, our data reveal novel functions of Fancd2 and Usp1 in maintaining the bone marrow HSC compartment and suggest that FA pathway disruption may account for bone marrow failure in FA patients.

show abstract

Section: Resultssupporting

confidence: 89%

Hematopoietic Stem Cell Defects in Mice with Deficiency of Fancd2 or Usp1

et al. 2010

View full text Add to dashboard Cite

show abstract

“…Polymerase chain reaction (PCR) was performed as follows: 94°C, 30 seconds; 55–60°C, 1 minute; and 72°C, 1 minute for 40 cycles. Primer sequences for the following genes are published: Angiopoietin‐1 ( Ang‐1 ), Angiopoietin‐2 ( Ang‐2 ), Tie‐1 , Tie‐2 , Flk‐1 and Flt‐1 [5], Flt‐4 [19], Cd34 [20], Endoglin [21], c‐kit [22], Aa4 [23], and Vcam‐1 [24]. We also designed primers for the following: Hhex , 5′‐ATCTCAGAGGATTCCGACCAGG‐3′ forward, 5′‐ATTCCCCAATGTTGCCCCCAC‐3′ reverse (513 bp); Cd133 , 5′‐GGAAAAGTTGCTCTGCGAACC‐3′ forward, 5′‐TGCTTGTTTGCTGGAGGGTC‐3′ reverse (608 bp); Tal1 , 5′‐GCCCAAAGATTTCCCCAATG‐3′ forward, 5′‐AAACCCAGTGCCCCAAACAC‐3′ reverse (543 bp); VE‐Cadherin 5′‐CAGCCAGCATCTTGAACCTG‐3′ forward, 5′‐GAGATTCACGAGCAGTTGGT‐3′ reverse (506 bp) and vWF 5′‐TGTTTTGTGGCGTGTATGTGAGG‐3′ forward, 5′‐GTGTTCTGGGTTTTCTGGAGTTTG‐3′ reverse (584 bp).…”

Section: Methodsmentioning

confidence: 99%

Isolation and Angiogenesis by Endothelial Progenitors in the Fetal Liver

et al. 2005

View full text Add to dashboard Cite

Endothelial progenitor cells (EPCs) have significant therapeutic potential. However, the low quantity of such cells available from bone marrow and their limited capacity to proliferate in culture make their use difficult. Here, we present the first definitive demonstration of the presence of true EPCs in murine fetal liver capable of forming blood vessels in vivo connected to the host's vasculature after transplantation. This population is particularly interesting because it can be obtained at high yield and has a high angiogenic capacity as compared with bone marrow-derived EPCs. The EPC capacity is contained within the CD31 ؉ Sca1؉ cell subset. We demonstrate that these cells are dependent for survival and proliferation on a feeder cell monolayer derived from the fetal liver. In addition, we describe a novel and easy method for the isolation and ex vivo proliferation of these EPCs. Finally, we used gene expression profiling and tandem mass spectrometry proteomics to examine the fetal liver endothelial progenitors and the feeder cells to identify possible proangiogenic growth factor and endothelial differentiation-associated genes. STEM CELLS 2006; 24:44 -54

show abstract

“…48 Using Fancg Ϫ/Ϫ mice as a model, multiple defects at the stem and precursor cell compartments have been characterized, including decreased repopulation potential, 49,50 a defect in stem cell cycling, 51 and increased sensitivity to nitric oxide. 52 However, these defects do not result in spontaneous bone marrow failure, indicating that, unlike human beings, mice can compensate for defective stem/precursor cell dysfunction, perhaps related to their longer telomeres.…”

Section: Telomerase Activity Maintains Telomere Length In Fancg ؊/؊ Hmentioning

confidence: 99%