Expression of Cre recombinase in mouse oocytes: A means to study maternal effect genes

Vries, Wilhelmine N. de; Binns, Lorraine T.; Fancher, Karen; Dean, Jurrien; Moore, Robert H.; Kemler, Rolf; Knowles, Barbara B.

doi:10.1002/(sici)1526-968x(200002)26:2<110::aid-gene2>3.0.co;2-8

Cited by 332 publications

(230 citation statements)

References 6 publications

Supporting

Mentioning

227

Contrasting

Order By: Relevance

“…To date, it is widely accepted that the first phase of embryonic development is dependent on maternal transcripts and proteins accumulated during oogenesis until broad embryonic genome activation after combination and reprogramming of maternal and paternal genomes (43,44). The finding that embryos from cKO mice develop normally suggests that mater- nal Rictor is dispensable for oocyte-to-embryo transition or that transcripts controlled by Rictor/mTORC2 accumulated before the primary follicle are sufficient for preimplantation embryonic development because Zp3-Cre has been shown to express Cre recombinase in oocytes at the primary and/or later follicular stages (34).…”

Section: Discussionmentioning

confidence: 99%

“…4D, although cKO mice had fewer small follicles (including primordial and primary follicles) than control mice, this difference was not statistically significant. It has been shown that ZP3-Cre-mediated gene deletion occurs at the primary and/or later follicular stages (34), and thus deprivation of Rictor in oocytes did not cause significant primordial follicle loss. Indeed, massive follicle loss in cKO mice occurred at large and mature follicles (Fig.…”

Section: Loss Of Rictor In Oocytes Causes Progressively Extensive Celmentioning

confidence: 99%

See 1 more Smart Citation

Rictor/mTORC2 Pathway in Oocytes Regulates Folliculogenesis, and Its Inactivation Causes Premature Ovarian Failure

Chen

Kang

Wang

et al. 2015

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background:The roles of Rictor/mTORC2 in folliculogenesis and follicle survival are unknown. Results: Loss of Rictor in oocytes causes excessive follicular atresia and the mutant mice demonstrate progressive POF phenotype. Conclusion: Rictor/mTORC2 plays key roles in folliculogenesis, follicle survival, and female fertility. Significance: This study establishes a novel function of mTORC2 in folliculogenesis and a potential link between mTORC2 and POF.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Loss Of Rictor In Oocytes Causes Progressively Extensive Celmentioning

confidence: 99%

Rictor/mTORC2 Pathway in Oocytes Regulates Folliculogenesis, and Its Inactivation Causes Premature Ovarian Failure

Chen

Kang

Wang

et al. 2015

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Mice carrying the following alleles were used: Tg(Zp3-cre)82Knw, hereafter named Zp3-Cre tg (de Vries et al, 2000), Tg(Sox2-cre)1Amc, hereafter named Sox2-Cre tg (Hayashi et al, 2002), Gt(ROSA)26Sor tm1(Notch1)Dam , hereafter named Rosa26 N1ICD (Murtaugh et al, 2003), Rbpj tm1.Hon and Rbpj tm1.1.Hon , hereafter named Rbpj flox and Rbpj Δ (Tanigaki et al, 2002). Genotyping of mice was performed using conditions described in Souilhol et al (2006) for the Cre lines and Rbpj flox and Rbpj Δ alleles, and in Soriano (1999) for Rosa26 N1ICD allele.…”

Section: Generation Of Mice and Embryosmentioning

confidence: 99%

NOTCH activation interferes with cell fate specification in the gastrulating mouse embryo

et al. 2015

View full text Add to dashboard Cite

NOTCH signalling is an evolutionarily conserved pathway involved in intercellular communication essential for cell fate choices during development. Although dispensable for early aspects of mouse development, canonical RBPJ-dependent NOTCH signalling has been shown to influence lineage commitment during embryonic stem cell (ESC) differentiation. NOTCH activation in ESCs promotes the acquisition of a neural fate, whereas its suppression favours their differentiation into cardiomyocytes. This suggests that NOTCH signalling is implicated in the acquisition of distinct embryonic fates at early stages of mammalian development. In order to investigate in vivo such a role for NOTCH signalling in shaping cell fate specification, we use genetic approaches to constitutively activate the NOTCH pathway in the mouse embryo. Early embryonic development, including the establishment of anterior-posterior polarity, is not perturbed by forced NOTCH activation. By contrast, widespread NOTCH activity in the epiblast triggers dramatic gastrulation defects. These are fully rescued in a RBPJ-deficient background. Epiblast-specific NOTCH activation induces acquisition of neurectoderm identity and disrupts the formation of specific mesodermal precursors including the derivatives of the anterior primitive streak, the mouse organiser. In addition, we show that forced NOTCH activation results in misregulation of NODAL signalling, a major determinant of early embryonic patterning. Our study reveals a previously unidentified role for canonical NOTCH signalling during mammalian gastrulation. It also exemplifies how in vivo studies can shed light on the mechanisms underlying cell fate specification during in vitro directed differentiation.

show abstract

“…Removal of the neo selection marker was achieved by crossing male CLN2 +/− mice with female Zp3-cre mice (The Jackson Laboratory, Bar Harbor, Maine) which is a transgenic line in a C57BL/6 background that expresses cre within the oocyte from the zona pellucida 3 gene promoter [13]. Progeny of this mating were screened for cre-mediated excision of neo by using primers (ATCTGATGGCTACTGGGTGG, CCCGGTAGAATTCCGATCAT and CCCCCAAACACTGGAGTAGA) that generate 402 nt and 328 nt products from the wildtype and neo-containing targeted alleles, respectively and 529 nt from the mutant allele after excision of neo (Fig.…”

Section: Generation Of Cln2 Mouse Hypomorphsmentioning

confidence: 99%

Residual levels of tripeptidyl-peptidase I activity dramatically ameliorate disease in late-infantile neuronal ceroid lipofuscinosis

Sleat¹,

El-Banna²,

Sohár³

et al. 2008

Molecular Genetics and Metabolism

View full text Add to dashboard Cite

Classical late-infantile neuronal ceroid lipofuscinosis (LINCL) is a hereditary neurodegenerative disease of childhood that is caused by mutations in the gene (CLN2) encoding the lysosomal protease tripeptidyl-peptidase I (TPPI). LINCL is fatal and there is no treatment of demonstrated efficacy in affected children but preclinical studies with AAV-mediated gene therapy have demonstrated promise in a mouse model. Here, we have generated mouse CLN2 mutants that express different amounts of TPPI activity to benchmark levels required for therapeutic benefits. Approximately 3% of normal TPPI activity in brain delayed disease onset and doubled lifespan to a median of ~9 months compared to mice expressing ~0.2% of normal levels. Expression of 6% of normal TPPI activity dramatically attenuated disease, with a median lifespan of ~20 months which approaches that of unaffected mice. While the life-span of this hypomorph is shortened, disease is late-onset, less severe and progresses slowly compared to mice expressing lower TPPI levels. For gene therapy and other approaches that restore enzyme activity, these results suggest that 6% of normal TPPI activity throughout the CNS of affected individuals will provide a significant therapeutic benefit but higher levels will be required to cure this disease.

show abstract

Expression of Cre recombinase in mouse oocytes: A means to study maternal effect genes

Cited by 332 publications

References 6 publications

Rictor/mTORC2 Pathway in Oocytes Regulates Folliculogenesis, and Its Inactivation Causes Premature Ovarian Failure

Rictor/mTORC2 Pathway in Oocytes Regulates Folliculogenesis, and Its Inactivation Causes Premature Ovarian Failure

NOTCH activation interferes with cell fate specification in the gastrulating mouse embryo

Residual levels of tripeptidyl-peptidase I activity dramatically ameliorate disease in late-infantile neuronal ceroid lipofuscinosis

Contact Info

Product

Resources

About