Expression of bioactive anti-CD20 antibody fragments and induction of ER stress response in Arabidopsis seeds

Abstract

Seed-based expression system is an attractive platform for the production of recombinant proteins in molecular farming. Despite the many advantages of molecular farming, little is known about the effect of the different subcellular accumulation of recombinant proteins on the endoplasmic reticulum (ER) quality control system in host plants. In this study, we analyzed the expression of anti-CD20 antibody fragments in seeds of Arabidopsis thaliana (ecotype Columbia) and corresponding glycosylation mutants, and evaluated the influence of three different signal sequences on the expression levels of scFv-Fc of C2B8. The highest protein accumulation level, with a maximum of 6.12 % total soluble proteins, was observed upon fusing proteins to the signal peptide of Arabidopsis seed storage albumin 2. The ER stress responses in developing seeds at 13 days post-anthesis were also compared across different transgenic lines under normal and heat shock conditions. Based on the gene expression profiles of ER stress transducers, our results suggest that accumulation of antibody fragments in the ER exerts more stress on ER homeostasis. In addition, quantitative PCR results also implicate enhanced activation of ER-associated degradation in transgenic lines. Last but not the least, we also demonstrate the anti-tumor potency of plant-derived proteins by showing the anti-tumor activity of purified scFv-Fc proteins against Daudi cells. Together, our data implies that better understanding of the interaction between exogenous protein production and the cellular quality control system of the host plant is necessary for the development of an optimal expression strategy that will be especially beneficial to commercial protein manufacturing.

Expression of Single Chain Variable Fragment (scFv) Molecules in Plants: A Comprehensive Update

“…Well-characterized in vitro propagation, transformation, and maintenance methods of these plants are the factors behind their selection. The protein was expressed in whole plant tissue [66,68,69], leaves [70][71][72][73][74][75], flower [76], seeds [77][78][79][80][81], hairy root culture [82] or tobacco BY-2 (tobacco cultivar Bright Yellow) cells [8,83,84] (Fig. 4).…”

Russell-Like Bodies in Plant Seeds Share Common Features With Prolamin Bodies and Occur Upon Recombinant Protein Production

“…qPCR using SYBR green detection (5× HOT FIREPol ® EvaGreen qPCR Mix Plus wo ROX, Solis BioDyne) was carried out in a Rotor-Gene 3000 (Corbett Research) with the running profile: 95°C for 12 min followed by 40 cycles of 95°C for 5 s, 55/59°C ( BIP3 / LSM4 ) for 5 s, 72°C for 20 s. The run was completed by a melting analysis from 65 to 95°C rising by 1°C steps. Forward and reverse primers for BIP3 were taken from Wang et al (2015). Small nuclear ribonucleoprotein family protein LSM4 (AT5G27720) was used as internal control gene, using primers 5′ACCACCAGGTGTTGGACGTG3′ and 5′CATCAACCACGGCCGCGAC3′.…”

“…In cereals such as maize and rice that accumulate large amounts of endogenous storage protein in ER-derived protein bodies, in some cases, minor distortions of protein body morphology have been detected by electron microscopy upon the expression of recombinant proteins (Yang et al, 2012; Peters et al, 2013; Wang et al, 2013). Other studies have found that recombinant protein synthesis may correlate with an ER stress response (Wang et al, 2015) or cause specific grain phenotypes, such as an opaque endosperm (Oono et al, 2010; De Wilde et al, 2013). The immunolocalization of a recombinant antibody fragment in A. thaliana seeds revealed the aberrant localization of a proportion of KDEL-tagged antibody in the periplasmic space and in ER-derived compartments delimited by ribosome-associated membranes (Van Droogenbroeck et al, 2007).…”

Targeted genome editing of plants and plant cells for biomanufacturing

“…The expression of secreted recombinant proteins in plants often causes an imbalance between the amount of unfolded protein entering the secretory pathway and the protein folding machinery of the endoplasmic reticulum (ER), resulting in the induction of ER stress and an unfolded protein response (UPR) in which the cell increases its protein-folding capacity (Arcalis et al 2019;de Wilde et al 2013;Oono et al 2010;Wang et al 2015;Pastor-Cantizano et al 2020). The major UPR sensing system appears to be conserved in all eukaryotes, although different organisms utilize different subsets of ER-resident transmembrane sensors.…”