Evolutionary analysis of serotype A foot-and-mouth disease viruses circulating in Pakistan and Afghanistan during 2002–2009

Abstract

Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. Three different serotypes of the virus, namely O, A and Asia-1, are responsible for the outbreaks of this disease in these countries. In the present study, the nucleotide-coding sequences for the VP1 capsid protein (69 samples) or for all four capsid proteins (P1, seven representative samples) of the serotype A FMD viruses circulating in Pakistan and Afghanistan were determined. Phylogenetic analysis of the foot-and-mouth disease virus (FMDV) VP1-coding sequences from these countries collected between 2002 and 2009 revealed the presence of at least four lineages within two distinct genotypes, all belonging to the Asia topotype, within serotype A. The predominant lineage observed was A-Iran05 but three other lineages (a new one is named here A-Pak09) were also identified. The A-Iran05 lineage is still evolving as revealed by the presence of seven distinct variants, the dominant being the A-Iran05 AFG-07 and A-Iran05 BAR-08 sublineages. The rate of evolution of the A-Iran05 lineage was found to be about 1.2¾10 "2 substitutions per nucleotide per year. This high rate of change is consistent with the rapid appearance of new variants of FMDV serotype A in the region. The A22/Iraq FMDV vaccine is antigenically distinct from the A-Iran05 BAR-08 viruses. Mapping of the amino acid changes between the capsid proteins of the A22/Iraq vaccine strain and the A-Iran05 BAR-08 viruses onto the A22/Iraq capsid structure identified candidate amino acid substitutions, exposed on the virus surface, which may explain this antigenic difference.

Genetic diversity of serotype A foot-and-mouth disease viruses in Kenya from 1964 to 2013; implications for control strategies in eastern Africa

“…However, it was much lower than that recently reported by Jamal et al (2011a) Sangula et al, (2011).…”

“…In this study, nucleotide diversities In Asia, including India, Pakistan, Afghanistan and Bangladesh, where type A FMDV is also endemic, this serotype (albeit from the Asia topotype) co-exists with serotypes O and Asia 1 but serotype A is the most divergent and is responsible for most of the recent FMD outbreaks (Jamal et al, 2011a;Jamal et al, 2011b;Mittal et al, 2005;Nandi et al, 2013). In contrast, in Kenya serotypes O, SAT 1 and SAT 2 have caused most of the outbreaks, until the recent 2012 to 2013 upsurge of serotype A outbreaks.…”

“…(5'GAAGGGCCCAGGGTTGGACTC 3') as described by Jamal et al, (2011a) encompassing the complete VP1 coding sequence. The PCR products (ca.…”

“…circulating FMDVs is required to enable selection of the most appropriate vaccine strain (Bastos et al, 2003;Kitching, 2005), yet this has been seldom undertaken in Kenya. Elsewhere, large numbers of serotype A outbreaks have reported, in recent years, in Asia and the Middle-East (Jamal et al, 2011a;Nandi et al, 2013).…”

Phylodynamic reconstruction of O CATHAY topotype foot-and-mouth disease virus epidemics in the Philippines

“…These findings indicate that the O CATHAY The molecular clock estimated here for the O CATHAY topotype is at the high end of evolutionary rate estimates for FMDV. Previously estimates reported an average evolutionary rate across all FMDV serotype of 2.48 × 10 −3 nt/ site/yr [40], while rates of 3.14 × 10 −2 nt/site/yr) [46] was similar to the molecular clock for the O CATHAY topotype estimated by this study. Therefore, genotypically and regionally variable evolutionary rates may in fact reflect real differences in the epidemiological dynamics and hostinteraction of FMDV.…”