Evidence for BRAF mutation and variable levels of microsatellite instability in a syndrome of familial colorectal cancer

Young, Joanne; Barker, Melissa; Simms, Lisa A.; Walsh, Michael D.; Biden, Kelli G.; Buchanan, Daniel D.; Buttenshaw, Ron; Whitehall, Vicki; Arnold, Sven; Jackson, Leigh; Kambara, Takeshi; Spring, Kevin; Jenkins, Mark A.; Walker, Graeme J.; Hopper, John L.; Leggett, Barbara A.; Jass, Jeremy R.

doi:10.1016/s1542-3565(04)00673-1

Cited by 113 publications

(96 citation statements)

References 71 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The contribution of genetic factors to the development of CIMP þ is controversial, with some workers reporting an association between family history of CRC and CIMP þ (Frazier et al, 2003;Young et al, 2005), but not others (Ward et al, 2004). Functional polymorphisms in methyl group metabolism and DNA methylation genes are clearly interesting candidates for further study and are currently being investigated in large cohorts of well-defined CIMP þ tumours.…”

Section: Discussionmentioning

confidence: 99%

DNA hypermethylation in the normal colonic mucosa of patients with colorectal cancer

et al. 2006

View full text Add to dashboard Cite

The CpG-island methylator phenotype (CIMP þ ) in colorectal cancer (CRC) is characterised by frequent hypermethylation of promoter regions in tumour suppressor genes. Low level methylation of some CpG islands is also seen in the normal colonic mucosa and increases with age; however, it is still unclear what other factors regulate this phenomenon. The first aim of our study was to determine whether the level of promoter methylation is elevated in the normal colonic mucosa of patients with CIMP þ tumours. The second aim was to investigate whether common, functional polymorphisms in genes involved in methyl group metabolism are associated with the level of methylation in this tissue. CpG islands within the ERa, MYOD, P16(INK4A), MLH1, APC, P14(ARF), DAPK and TIMP3 genes were quantitatively evaluated for methylation in normal colonic mucosa from a large series of CRC patients using the MethyLight assay. Genotyping was carried out for polymorphisms in the MTHFR, TS, MS, MTHFD1 and DNMT3b genes. Methylation of ERa and MYOD in normal colonic mucosa increased with age and was higher in female subjects. Methylation of P16(INK4A), MLH1, TIMP3 and DAPK in normal mucosa occurred at a lower level than ERa and MYOD but also increased with age and was significantly higher in patients with CIMP þ tumours. The DNMT3b C46359T polymorphism was associated with significantly less methylation of MYOD and MLH1 and with trends for lower methylation in each of the other CpG islands examined. Our results demonstrate that age, gender and genetic factors can influence the methylation level of CpG islands in gene promoter regions of normal colonic mucosa. Further work is required to determine whether such methylation is associated with the development of CIMP þ CRC.

show abstract

Section: Discussionmentioning

confidence: 99%

DNA hypermethylation in the normal colonic mucosa of patients with colorectal cancer

et al. 2006

View full text Add to dashboard Cite

show abstract

“…21,22 Briefly, real-time PCR was performed using allelespecific primers designed to selectively amplify the wild-type (T1796) and mutant (A1796) BRAF alleles. The primer sequences were as follows: V, 5 0 -GTGATTTTGGTC TAGC TACtGT; E, 5 0 -CGCGG CCGGCCGCGGCGGTGATTTTGGTCTA GCTACcGA; and AS, 5 0 -TAGCCTCAATTCTTACCAT CCAC.…”

Section: Braf and Kras Mutation Analysismentioning

confidence: 99%

Clinicopathologic and molecular features of sporadic early-onset colorectal adenocarcinoma: an adenocarcinoma with frequent signet ring cell differentiation, rectal and sigmoid involvement, and adverse morphologic features

et al. 2012

View full text Add to dashboard Cite

Recent literature suggests an increasing incidence of colorectal carcinoma in young patients. We performed a histologic, molecular, and immunophenotypic analysis of patients with sporadic early-onset (r40 years of age) colorectal carcinoma seen at our institution from the years 2000-2010 and compared these tumors to a cohort of consecutively resected colorectal carcinomas seen in patients 440 years of age. A total of 1160 primary colorectal adenocarcinomas were surgically resected for the years 2000 through 2010. Of these, 75 (6%) were diagnoses in patients r40 years of age of which 13 (17%) demonstrated abnormalities in DNA mismatch repair, 4 (5%) were in patients with known germline genetic disorders (two patients with familial adenomatous polyposis, one patient with juvenile polyposis, and one patient with Li-Fraumeni syndrome), and three patients (4%) had long-standing chronic inflammatory bowel disease. The sporadic early-onset colorectal carcinoma group comprised a total of 55 patients (55/1160, 5%) and were compared with a control group comprising 73 consecutively resected colorectal carcinomas with proficient DNA mismatch repair in patients 440 years of age. For the early-onset colorectal carcinoma group, most cases (33/55, 60%) were diagnosed between the age of 35 and 40 years of age. Compared with the control group, the early-onset colorectal carcinoma group was significantly different with respect to tumor location (Po0.007) with 80% (44/55 cases) identified in either the sigmoid colon (24/55, 44%) or rectum (20/55, 36%). Morphologically, early-onset colorectal carcinomas more frequently displayed adverse histologic features compared with the control colorectal carcinoma group such as signet ring cell differentiation (7/55, 13% vs 1/73, 1%, P ¼ 0.021), perineural invasion (16/55, 29% vs 8/73, 11%, P ¼ 0.009) and venous invasion (12/55, 22% vs 4/73, 6%, P ¼ 0.006). A precursor adenomatous lesion was less frequently identified in the early-onset colorectal carcinoma group compared with the control group (19/55, 35% vs 39/73, 53%, P ¼ 0.034). Of the early-onset colorectal carcinomas, only 2/45 cases (4%) demonstrated KRAS mutations compared with 11/73 (15%) of the control group colorectal adenocarcinomas harboring KRAS mutations, although this difference did not reach statistical significance (P ¼ 0.13). BRAF V600E mutations were not identified in the early-onset colorectal carcinoma group. No difference was identified between the two

show abstract

“…Since its discovery through a genome-wide cancer resequencing effort (Davies et al 2002), mutations in BRAF have been detected in a variety of tumor types, with the highest incidence in melanoma (ranging from 27% to 70%) (Maldonado et al 2003;Pollock et al 2003;Uribe et al 2003;Daniotti et al 2004;Kumar et al 2004;Shinozaki et al 2004;Libra et al 2005), followed by papillary thyroid tumors, colorectal cancers, and ovarian cancers (Ciampi and Nikiforov 2005;Young et al 2005). These point mutations clustered in specific regions of biochemical importance, with the predominant melanoma mutation being a single phosphomimetic substitution in the kinase activation domain (V600E), which confers constitutive activation (Garnett and Marais 2004).…”

Section: The Ras Family Of Proto-oncogenes: H-ras N-ras and K-rasmentioning

confidence: 99%

Malignant melanoma: genetics and therapeutics in the genomic era

2006

View full text Add to dashboard Cite

Cell for cell, probably no human cancer is as aggressive as melanoma. It is among a handful of cancers whose dimensions are reported in millimeters. Tumor thickness approaching 4 mm presents a high risk of metastasis, and a diagnosis of metastatic melanoma carries with it an abysmal median survival of 6-9 mo. What features of this malignancy account for such aggressive behavior? Is it the migratory history of its cell of origin or the programmed adaptation of its differentiated progeny to environmental stress, particularly ultraviolet radiation? While the answers to these questions are far from complete, major strides have been made in our understanding of the cellular, molecular, and genetic underpinnings of melanoma. More importantly, these discoveries carry profound implications for the development of therapies focused directly at the molecular engines driving melanoma, suggesting that we may have reached the brink of an unprecedented opportunity to translate basic science into clinical advances. In this review, we attempt to summarize our current understanding of the genetics and biology of this disease, drawing from expanding genomic information and lessons from development and genetically engineered mouse models. In addition, we look forward toward how these new insights will impact on therapeutic options for metastatic melanoma in the near future. The diseaseMelanomas most often arise within epidermal melanocytes of the skin, although they can also derive from noncutaneous melanocytes such as those lining the choroidal layer of the eye, GI and GU mucosal surfaces, or the meninges. Melanoma is also among the more common causes of "metastatic cancer of unknown primary," which may reflect either a propensity to arise in unexpected sites along the neural crest migratory route, or rapid growth of poorly differentiated lesions arising from indolent or unrecognized cutaneous primary lesions. Clinical staging for primary cutaneous melanoma employs measurements of thickness (in millimeters), presence of ulceration, penetration through cutaneous layers, mitotic rate, evidence of "in transit" metastasis, tumor spread to draining lymph nodes, and evidence of distant metastasis. Management issues in melanoma can be classified in terms of prevention, diagnosis, local disease management, and treatment of metastatic disease.In view of the epidemiological and emerging experimental evidence linking melanoma incidence to UV exposure and skin phototype, prevention and screening strategies represent key areas for reduction of disease incidence and severity. For most cutaneous melanomas in the so-called radial growth phase (e.g., thin melanomas), surgical removal affords curative treatment. In contrast, a significant fraction of patients diagnosed with intermediate-thickness (2-4 mm) cutaneous melanoma eventually succumb to recurrence at regional or distant sites.Critical biological questions facing the melanoma research community include: (1) What genetic and environmental factors contribute to and/or modulate risk of melanom...

show abstract

Evidence for BRAF mutation and variable levels of microsatellite instability in a syndrome of familial colorectal cancer

Cited by 113 publications

References 71 publications

DNA hypermethylation in the normal colonic mucosa of patients with colorectal cancer

DNA hypermethylation in the normal colonic mucosa of patients with colorectal cancer

Clinicopathologic and molecular features of sporadic early-onset colorectal adenocarcinoma: an adenocarcinoma with frequent signet ring cell differentiation, rectal and sigmoid involvement, and adverse morphologic features

Malignant melanoma: genetics and therapeutics in the genomic era

Contact Info

Product

Resources

About