Essential cell-extrinsic requirement for PDIA6 in lymphoid and myeloid development

Abstract

In a forward genetic screen of N-ethyl-N-nitrosourea (ENU)–induced mutant mice for aberrant immune function, we identified mice with a syndromic disorder marked by growth retardation, diabetes, premature death, and severe lymphoid and myeloid hypoplasia together with diminished T cell–independent (TI) antibody responses. The causative mutation was in Pdia6, an essential gene encoding protein disulfide isomerase A6 (PDIA6), an oxidoreductase that functions in nascent protein folding in the endoplasmic reticulum. The immune deficiency caused by the Pdia6 mutation was, with the exception of a residual T cell developmental defect, completely rescued in irradiated wild-type recipients of PDIA6-deficient bone marrow cells, both in the absence or presence of competition. The viable hypomorphic allele uncovered in these studies reveals an essential role for PDIA6 in hematopoiesis, but one extrinsic to cells of the hematopoietic lineage. We show evidence that this role is in the proper folding of Wnt3a, BAFF, IL-7, and perhaps other factors produced by the extra-hematopoietic compartment that contribute to the development and lineage commitment of hematopoietic cells.

Biallelic loss of function variant in the unfolded protein response gene PDIA6 is associated with asphyxiating thoracic dystrophy and neonatal‐onset diabetes

“…The latter is due to the disruption of the critical function of PDIA6 in the development and lineage commitment of hematopoietic cells resulting in an age‐dependent lymphoid and myeloid hypoplasia. Consistent with the infantile‐onset diabetes reported in patients with EIF2AK3 biallelic inactivating variants and EIF2AK3 knockout mice, we showed that the braum/− mice developed a strong phenotype of early‐onset hyperglycemia that was detected as early as 4 weeks of age 3,11,14 …”

“…An N ‐ethyl‐ N ‐nitrosourea (ENU)‐induced missense mutation resulted in a valine (V) to alanine (A) substitution at position 32 (V32A; braum allele) in the first thioredoxin domain of the PDIA6 protein as described previously 3,20 . Heterozygous Pdia6 knockout ( Pdia6 +/− ) mice were generated using the CRISPR/Cas9 system with Pdia6 (5′‐ ACCGCTGACTGCTAGAAAGA‐3′) small base‐pairing guide RNA 21 .…”

“…elegans resulted in an exaggerated UPR and larval developmental failure, supporting a critical function of PDIA6 in maintaining the UPR within the developmentally and physiologically appropriate range 4 . We recently showed that homozygous knockout of PDIA6 in mice produced no homozygous pups, suggesting that complete depletion of PDIA6 is embryonic lethal in mice 3 . However, compound heterozygotes ( braum/− ) bearing the knockout allele in trans with a relatively milder allele ( braum ) displayed growth retardation, premature death, early‐onset hyperglycemia, and severe immunodeficiency.…”

“…It is abundantly expressed in various tissues in humans and mice (http://proteinatlas.org/ENSG00000143870-PDIA6/tissue). 3 Inositol requiring enzyme‐1α (IRE1α) is one of three known transmembrane sensors and activators of the unfolded protein response (UPR). PDIA6 directly interacts with and converts IRE1 to its monomeric inactive state, therefore, mitigating the UPR through negative regulation of IRE1α signaling 4 .…”

“…Therefore, PDIA6 attenuates the UPR via direct interaction and regulation of the IRE1 and EIF2AK3 sensors and their associated and independent UPR signaling pathways 4,5 . As part of its chaperone and quality functions, wild type and misfolded proinsulin are known putative substrates for PDIA6 3,6 . At the site of blood vessel injury, the secreted PDIA6 from the endothelial cells and platelets interacts directly with the integrin β3 subunit to promote platelet activation and thrombus formation in vivo 7,8 .…”