Electroconvulsive seizure‐induced gene expression profile of the hippocampus dentate gyrus granule cell layer

Abstract

Electroconvulsive shock (ECS) is the most effective treatment for depression, but the mechanism underlying the therapeutic action of this treatment is still unknown. To better understand the molecular changes that may be necessary for the clinical effectiveness of ECS we have combined the technologies of gene expression profiling using cDNA microarrays with T7-based RNA amplification and laser microdissection to identify regulated genes in the dentate gyrus granule cell layer of the hippocampus. We have identified genes previously reported to be up-regulated following ECS, including brain-derived neurotrophic factor, neuropeptide Y, and thyrotrophin releasing hormone, as well as several novel genes. Notably, we have identified additional genes that are known to be involved in neuroprotection, such as growth arrest DNA damage inducible beta (Gadd45beta), and the excitatory amino acid transporter-1 (EAAC1/Slc1A1). In addition, via in situ hybridization we show that EAAC1 is specifically up-regulated in the dentate gyrus, but not in other hippocampal subfields. This study demonstrates the utility of microarray analysis of microdissected subregions of limbic brain regions and identifies novel ECS-regulated genes. Keywords: EAAC1, glutamate transporter, laser microdissection, microarray, neuroprotection, RNA amplification.Depression is a devastating illness that affects 12-15% of people at some point in their lives (Kessler et al. 2003). Current chemical treatments are only partially effective, alleviating symptoms for only approximately 65% of depressed individuals, and require weeks or months of administration to achieve a therapeutic response. Electroconvulsive shock (ECS) is an extremely effective, nonchemical treatment for depression, often efficacious in cases that are resistant to chemical antidepressants.Despite the clinical usefulness of ECS, the mechanisms underlying the therapeutic actions of this treatment are currently unknown. Previous reports have documented gene expression changes in the hippocampus Altar et al. 2004) and other brain regions (Yamada et al. 2002) following ECS that could contribute to adaptive changes underlying the therapeutic actions of ECS. Although there has been progress made using these traditional gene expression profiling techniques, these data sets still have shortcomings because they represent detectable changes that occur within large subregions of the brain (e.g. hippocampus or frontal cortex) constituting multiple cell types and independently acting neuronal circuits. This could result in dilution of important gene expression changes, underscoring the importance of utilizing methods that can increase signals from discrete brain regions and/or cell types. Recent advances in laser microdissection methodologies coupled with T7-based RNA amplification and gene expression detection technologies have made it feasible to determine gene expression profiles from discrete regions of the brain as well as from single cells (Bonaventure et al. 2002;Kelz et al. 2002;Kamme et al....

The Neuropeptide VGF Produces Antidepressant-Like Behavioral Effects and Enhances Proliferation in the Hippocampus

“…The fact that 5-HT does not regulate expression of all BDNF-induced genes suggests that BDNF is involved in numerous cellular processes, whereas 5-HT may have a more defined role in the hippocampus. The common set of specific genes we identified as regulated by both 5-HT and BDNF relate to neuronal activation, synaptic remodeling, and neuropeptides, and parallels those classes of genes altered by various antidepressant treatments (Newton et al, 2003;Altar et al, 2004;Alfonso et al, 2005;Yamada and Higuchi, 2005;Ploski et al, 2006;Conti et al, 2007).…”

Expression of BDNF and trkB in the hippocampus of a rat genetic model of vulnerability (Roman low‐avoidance) and resistance (Roman high‐avoidance) to stress‐induced depression

“…There is also growing evidence that antidepressant treatments may exert some of their therapeutic effects by increasing BDNF expression levels and affecting BDNF transcription in the hippocampus. Thus, (i) electroconvulsive brain stimulation, a treatment of choice for medication‐resistant depression, increases the hippocampal contents of BDNF and trkB mRNAs (Altar, Whitehead, Chen, Wörtwein, & Madsen, 2003; Angelucci, Aloe, Jiménez‐Vasquez, & Mathé, 2002; Nibuya et al., 1995), particularly in the dorsal hippocampus (Ploski et al., 2006), (ii) antidepressant treatment rapidly elevates the content of BDNF mature protein via posttranscriptional mechanisms, prevents the stress‐induced decrease in the hippocampal concentration of BDNF mRNA and counteracts the depression‐associated alterations in neural plasticity by normalizing BDNF in the rodent prefrontal cortex and hippocampus (Baj et al., 2012; Kozisek et al., 2008; Musazzi et al., 2009). In keeping with these experimental findings, postmortem samples from clinically depressed patients treated with antidepressant medications show increased BDNF immunoreactivity in the hilus, the dentate gyrus and the supragranular regions of the hippocampus as compared with antidepressant‐untreated controls (Chen, Dowlatshahi, MacQueen, Wang, & Young, 2001).…”

“…However, previous studies have shown that, in rats, the bilateral infusion of BDNF into the dentate gyrus of the dorsal hippocampus produces antidepressant‐like effects in behavioral depression models (Shirayama, Chen, Nakagawa, Russell, & Duman, 2002); moreover, in the dorsal hippocampus, chronic electroconvulsive treatment increases the acute electroconvulsive induction and prolongs the expression of BDNF and trkB mRNA (Nibuya et al., 1995), and also up‐regulates the expression of the gene encoding BDNF in the dentate gyrus granule cell layer (Ploski, Newton, & Duman, 2006). Hence, the present study was designed to characterize the hippocampal distribution of BDNF and its receptor trkB in RHA and RLA rats under baseline conditions, with special focus on the dorsal hippocampus, using Western blot (WB) and immunohistochemistry techniques.…”

The Activity-Regulated Cytoskeletal-Associated Protein (Arc/Arg3.1) Is Required for Memory Consolidation of Pavlovian Fear Conditioning in the Lateral Amygdala

“…Quantitative real-time PCR (qRT-PCR) was performed using the ⌬⌬Ct method as described previously (Ploski et al, 2006) using qRT-PCR primers for Arc/Arg3.1 (forward primer CCCTGCAGCCCAAGT-TCAAG; reverse primer GAAGGCTCAGCTGCCTGCTC). Relative gene concentrations were normalized against GAPDH (forward primer GCATCCTGCACCACCAACTG; reverse primer ACGCCACAGCTT-TCCAGAGG).…”