Effects of aging on apoptosis gene expression in oral mucosal tissues

J Clinic Periodontology

Kirakodu

et al. 2016

Self Cite

Aim Cellular and molecular immunoinflammatory changes in gingival tissues drive alveolar bone loss in periodontitis. Since aging is a risk factor for periodontitis, we sought to identify age-related gingival transcriptome changes associated with bone metabolism in both healthy and in naturally-occurring periodontitis. Materials and Methods Adult (12–16 years) and aged (18–23 years) non-human primates (M. mulatta) (n=24) were grouped into healthy and periodontitis. Gingival tissue samples were obtained and subjected to microarray analysis using the Gene Chip Macaque Genome Array. Gene expression profiles involved in osteoclast/osteoblast proliferation, adhesion, and function were evaluated and compared across and between the age groups. QPCR was also performed on selected genes to validate microarray data. Results Healthy aged tissues showed a gene profile expression that suggest enhancement of osteoclastic adhesion, proliferation/survival and function (SPP1, TLR4, MMP8, and TFEC) and impaired osteoblastic activity (SMEK3P and SMAD5). The gingival transcriptome in both adult and aged animals with naturally-occurring periodontitis (FOS, IL6, TLR4, MMP9, MMP10 and SPP1 genes) was consistent with a local inflammatory response driving towards bone/connective tissue destruction. Conclusion A pro-osteoclastogenic gingival transcriptome is associated with periodontitis irrespective of age; however; a greater bone-destructive molecular environment is associated with aging in healthy tissues.

Section: Discussionsupporting

confidence: 85%

Bone biology‐related gingival transcriptome in ageing and periodontitis in non‐human primates

Pandruvada

J Clinic Periodontology

Kirakodu

et al. 2016

Self Cite

“…These results suggested a differential pattern of macrophage infiltration/differentiation/maturation in aged healthy tissues that tended towards increased inflammatory and tissue destructive macrophages (M1), even in healthy aged tissues. Thus, as we have found previously exploring gene expression profiles for other pathways (Gonzalez, Stromberg, Huggins, Gonzalez-Martinez, Novak and Ebersole, 2011, Gonzalez, John Novak, Kirakodu, Stromberg, Shen, Orraca, Gonzalez-Martinez and Ebersole, 2013, Gonzalez, Novak, Kirakodu, Orraca, Chen, Stromberg, Gonzalez-Martinez and Ebersole, 2014, Ebersole, Kirakodu, Novak, Stromberg, Shen, Orraca, Gonzalez-Martinez, Burgos and Gonzalez, 2014), while apparently clinically healthy, the aged gingival tissues seem to be fundamentally altered in the local environmental milieu of cellular functions that may present an enhanced predisposition to a tissue destructive process when challenged with a more pathogenic microbial stimulus. Additionally, in periodontitis tissues, increases in gene expression reflecting an increase in total macrophage populations appeared to be primarily related to increases in M1 cells, reflecting a response more skewed towards tissue destructive inflammation than was observed even in the adult periodontitis tissues.…”

Section: Discussionsupporting

confidence: 53%

“…Based upon the microarray outcomes we selected 5 genes and performed a qPCR analysis using a standard technique in our laboratory employing a Roche 480 LightCycler (Gonzalez, John Novak, Kirakodu, Stromberg, Shen, Orraca, Gonzalez-Martinez and Ebersole, 2013). Primers were prepared for IL6 (forward - CCTGAACCAACCACAAATGC; reverse – GGACTGCAGGAACTCCTTAAA; amplicon 114 bp), CXCL13 (forward – AGTCT GGAAGAAGAACAAGTCAG; reverse – GGAACTGGTGGAGTTGAAGAA; amplicon 108 bp), CCL19 (forward - GCTACCTTCTCATCAAGGATGG; reverse – GTTCTACCCAG GACTGGTCT; amplicon 102 bp), CD14 (forward - GCCCTAAACTCCCTCAATCTG; reverse – CAGTCTGTTGCAGCTGAGAT; amplicon 99 bp) and IL1R2 (forward – TTTCAGACACTACGCACCAC; reverse – ACCGTCTGTGCATCCATATTC; amplicon 118 bp) and GAPDH (forward – GGTGTGAACCATGAGAAGTATGA; reverse – GAGTCCTTCCACGATACCAAAG; amplicon 123 bp) genes, designed using software PrimerQuest at Integrated DNA Technologies website (www.idtdna.com) and were synthesized by Integrated DNA Technologies, Inc (Coralville, IA).…”

Section: Methodsmentioning

confidence: 99%

“…Primers were prepared for IL6 (forward - CCTGAACCAACCACAAATGC; reverse – GGACTGCAGGAACTCCTTAAA; amplicon 114 bp), CXCL13 (forward – AGTCT GGAAGAAGAACAAGTCAG; reverse – GGAACTGGTGGAGTTGAAGAA; amplicon 108 bp), CCL19 (forward - GCTACCTTCTCATCAAGGATGG; reverse – GTTCTACCCAG GACTGGTCT; amplicon 102 bp), CD14 (forward - GCCCTAAACTCCCTCAATCTG; reverse – CAGTCTGTTGCAGCTGAGAT; amplicon 99 bp) and IL1R2 (forward – TTTCAGACACTACGCACCAC; reverse – ACCGTCTGTGCATCCATATTC; amplicon 118 bp) and GAPDH (forward – GGTGTGAACCATGAGAAGTATGA; reverse – GAGTCCTTCCACGATACCAAAG; amplicon 123 bp) genes, designed using software PrimerQuest at Integrated DNA Technologies website (www.idtdna.com) and were synthesized by Integrated DNA Technologies, Inc (Coralville, IA). The level of message was determined (Gonzalez, John Novak, Kirakodu, Stromberg, Shen, Orraca, Gonzalez-Martinez and Ebersole, 2013, Gonzalez, Novak, Kirakodu, Orraca, Chen, Stromberg, Gonzalez-Martinez and Ebersole, 2014, Ebersole, Kirakodu, Novak, Stromberg, Shen, Orraca, Gonzalez-Martinez, Burgos and Gonzalez, 2014) and those levels compared across the RNA samples prepared from each of the healthy groups and the 2 periodontitis groups.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Differential Gene Expression Profiles Reflecting Macrophage Polarization in Aging and Periodontitis Gingival Tissues

Immunological Investigations

Novak

Kirakodu

et al. 2015

SUMMARY Recent evidence has determined a phenotypic and functional heterogeneity for macrophage populations. This plasticity of macrophage function has been related to specific properties of subsets (M1, M2) of these cells in inflammation, adaptive immune responses, and resolution of tissue destructive processes. This investigation hypothesized that targeted alterations in the distribution of macrophage phenotypes in aged individuals, and with periodontitis would be skewed towards M1 inflammatory macrophages in gingival tissues. The study used a nonhuman primate model to evaluate gene expression profiles as footprints of macrophage variation in healthy and periodontitis gingival tissues from animals 3–23 years of age and in periodontitis tissues in adult and aged animals. Significant increases in multiple genes reflecting overall increases in macrophage activities were observed in healthy aged tissues, and were significantly increased in periodontitis tissues from both adults and aged animals. Generally, gene expression patterns for M2 macrophages were similar in healthy young, adolescent, and adult tissues. However, modest increases were noted in healthy aged tissues, similar to those seen in periodontitis tissues from both age groups. M1 macrophage gene transcription patterns increased significantly over the age range in healthy tissues, with multiple genes (e.g. CCL13, CCL19, CCR7, TLR4) significantly increased in aged animals. Additionally, gene expression patterns for M1 macrophages were significantly increased in adult health versus periodontitis and aged healthy versus periodontitis. The findings supported a significant increase in macrophages with aging and in periodontitis. The primary increases in both healthy aged tissues and, particularly periodontitis tissues appeared in the M1 phenotype.

“…These included AIRE (role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells), CIITA (essential for transcriptional activity of the HLA class II promoter), NFATC1 (plays a role in the inducible expression of cytokine genes in T-cells, especially in the induction of the IL-2 or IL-4 gene transcription), NFKB1 (pleiotropic transcription factor present in almost all cell types responds to a vast array of stimuli for many biological processes, including inflammation, immunity, and apoptosis), SKI (a repressor of TGFβ signaling), SOCS1 (part of a classical negative feedback system that regulates cytokine signal transduction), and TP53 (regulates expression of target genes related to cell cycle arrest, apoptosis, and senescence). While the exact relationship among this array of transcription factors is not obvious, it does appear that they relate to T cell regulation of responses, control of anti- and pro-inflammatory responses, and can contribute to increased apoptosis, which we have noted previously in young tissues (16, 48). This was also observed with multiple pro-apoptotic genes that were elevated in the young tissues (PDCD2, TNFSF10, TNFSF15).…”

Section: Discussionmentioning

confidence: 73%

Immune system transcriptome in gingival tissues of young nonhuman primates

J of Periodontal Research

Nagarajan

Novak

et al. 2015

Young/adolescent humans demonstrate many microorganisms associated with periodontal disease in adults and substantial gingival inflammatory responses. However, younger individuals do not demonstrate the soft and hard tissue destruction that hallmark periodontitis. This study evaluated responses to the oral microbial ecology in gingival tissues from clinically healthy young Macaca mulatta (<3 years old) compared to older animals (5-23 years old). Global transcriptional profiling of four age groups revealed a subset of 159 genes that were differentially expressed at least across one of the age comparisons. Correlation metrics generated a relevance network abstraction of these genes. Partitioning of the relevance network revealed seven distinct communities comprising functionally related genes associated with host inflammatory and immune responses. A group of genes were identified that were selectively increased/decreased or positively/negatively correlated with gingival profiles in the animals. A Principal Components Analysis created metagenes of expression profiles for classifying the 23 animals. The results provide novel system-level insights into gene expression differences in healthy young tissues weighted towards host responses that were associated with anti-inflammatory biomolecules or those linked with T cell regulation of responses. The combination of the regulated microenvironment may help to explain the apparent “resistance” of younger individuals to developing periodontal disease.