EF-hand domains are involved in the differential cellular distribution of dystrophin Dp40

Aragón, Jorge; Martínez-Herrera, Alejandro; Bermúdez‐Cruz, Rosa María; Bazán, Ma. Luisa; Soid-Raggi, Gabriela; Ceja, Víctor; Coy-Arechavaleta, Andrea Santos; Aleman, Victor; Depardón, Francisco; Montañéz, Cecilia

doi:10.1016/j.neulet.2015.05.038

Cited by 11 publications

(21 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We have previously reported that PC12 cells express Dp71d, Dp71f (Marquez et al 2003), Dp71e (Saint Martín et al 2012, and Dp40 (Aragón et al 2015). For this work, we aimed to identify all Dp71 isoforms expressed in PC12 cells at the mRNA level and to examine the localizations of these isoforms expressed as recombinant proteins.…”

Section: Resultsmentioning

confidence: 98%

Identification of Dp71 Isoforms Expressed in PC12 Cells: Subcellular Localization and Colocalization with β-Dystroglycan and α1-Syntrophin

et al. 2015

Self Cite

View full text Add to dashboard Cite

Several dystrophin Dp71 messenger RNA (mRNA) alternative splice variants have been described. According to the splicing of exon 78 or intron 77, Dp71 proteins are grouped as Dp71d, Dp71f, and Dp71e, and each group has a specific C-terminal end. In this study, we explored the expression of Dp71 isoforms at the complementary DNA (cDNA) level and the subcellular localization of recombinant Myc-Dp71 proteins in PC12 cells. We determined that PC12 cells express Dp71a, Dp71c, Dp71ab, Dp71e, and Dp71ec mRNA splice variants. In undifferentiated and nerve growth factor-differentiated PC12 Tet-ON cells, Dp71a, Dp71ab, and Dp71e were found to localize and colocalize with β-dystroglycan and α1-syntrophin in the periphery/cytoplasm, while Dp71c and Dp71ec were mainly localized in the cell periphery and showed less colocalization with β-dystroglycan and α1-syntrophin. The levels of Dp71a, Dp71e, and Dp71ec were increased in the nucleus of differentiated PC12 Tet-ON cells compared to undifferentiated cells. Dp71 isoforms were also localized in neurite extensions and growth cones.

show abstract

Section: Resultsmentioning

confidence: 98%

Identification of Dp71 Isoforms Expressed in PC12 Cells: Subcellular Localization and Colocalization with β-Dystroglycan and α1-Syntrophin

et al. 2015

Self Cite

View full text Add to dashboard Cite

show abstract

“…Although RNA-Seq technology showed that cryptic splice sites in four DMD exons were activated in adult human skeletal muscle, exon 75s had never been identified [12]. Dp116b75s is expected to produce a C-terminal truncated Dp116, as Dp40 encoded in a transcript containing part of a DMD intron has been reported functional [31,32].…”

Section: Discussionmentioning

confidence: 99%

Schwann cell-specific Dp116 is expressed in glioblastoma cells, revealing two novel DMD gene splicing patterns

Rani

Maeta

Kawaguchi

et al. 2019

Biochemistry and Biophysics Reports

View full text Add to dashboard Cite

BackgroundThe DMD gene is one of the largest human genes, being composed of 79 exons. Dystrophin Dp116 expressed from the promoter in intron 55 is a Schwann cell-specific isoform. The pathophysiological roles of Dp116 are largely unknown, because of its limited expression. This study assessed the expression of Dp116 in glioblastoma cells and evaluated the splicing patterns of the DMD gene in these cells.MethodsFull-length Dp116 cDNA was PCR amplified from U-251 glioblastoma cells. Dp116 protein was analyzed by Western blotting.ResultsFull-length Dp116 cDNA, extending from exon S1 to exon 79, was PCR amplified to avoid confusion with other DMD isoforms. The full-length Dp116 transcript was amplified as nearly 3 kb in size. Western blotting of U-251 cell lysates revealed a signal at a position corresponding to vector-expressed Dp116 protein, indicating that Dp116 is expressed in glioblastoma cells. Sequencing of the amplified product revealed five splice variants, all skipping exon 78. The most abundant transcript lacked only exon 78 (Dp116b), whereas the second most abundant transcript lacked both exons 71 and 78 (Dp116ab). A third transcript lacking exons 71–74 and 78 was also identified (Dp116bc). Two novel splicing patterns were also observed, one with a deletion of exons 68 and 69 (Dp116bΔ68-69) and the other with a 100 bp deletion in the 5’ terminal end of exon 75 (75s), which was produced by the activation of a cryptic splice acceptor site (Dp116b75s). However, the splicing patterns in glioblastoma cells of DMD exons in Dp116 and Dp71 showed no significant differences.ConclusionsDp116 is expressed in glioblastoma cells as five splicing variants, with Dp116b being the most abundant. Two novel splicing patterns of DMD exons were observed.

show abstract

“…The cDNA fragments of Dp40 and Dp40 L170P were obtained from the vectors pcDNA4/HisMax-TOPO/Dp40 and pcDNA4/HisMax-TOPO/Dp40 L170P [3] through ampli cation by PCR using the primers 5´TAGATCACGCGTACATGAGGGAACACCTCAAAGGC3´ (pTRE-MluI) and 5´GATCTAGCGGCCGCTCACGTTTCCATGTTGTCCCCCTCTAAC3´ (Dp40-NotI), which add the restriction sites MluI and NotI, respectively. The DNA sequence of Dp40 corresponds to the Rattus norvegicus sequence reported in GenBank (KF154977.1).…”

Section: Vector Constructionmentioning

confidence: 99%

“…In PC12 cells, transient expression of Dp40 showed that it is located in the membrane and cytoplasm of undifferentiated cells, while its subcellular distribution changes in NGF-differentiated PC12 cells at day 3 post-treatment, when it is located in the membrane and cytoplasm with a signi cant increase in the nucleus. In addition, the mutant Dp40 L170P has a change in residue 170 from leucine to proline, promoting exclusive nuclear localization in PC12 cells [3]. Furthermore, Dp40 colocalized with β-DG opposite to Dp40 L170P in NGF-differentiated PC12 cells [3].…”

Section: Introductionmentioning

confidence: 98%

Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells

García-Cruz

Merino-Jiménez

Aragón

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Dp40 is ubiquitously expressed, including in the central nervous system. Dp40 mRNA and protein are detected in the early stages and postnatal stages of the mouse brain, respectively. In addition to being present in the nucleus, membrane, and cytoplasm, Dp40 is detected in neurites and postsynaptic spines in hippocampal neurons. Although Dp40 is expressed from the same promoter as Dp71, its role in the cognitive impairment present in Duchenne muscular dystrophy patients is still unknown. Here, we studied the effects of overexpression of Dp40 and Dp40L170P (a mutant of Dp40) during the neuronal differentiation process of PC12 Tet-On cells. We found that Dp40 overexpression increased the percentage of PC12 cells with neurites and neurite length, while Dp40L170P overexpression decreased them compared to Dp40 overexpression. Two-dimensional gel electrophoresis analysis carried out in nerve growth factor-differentiated PC12-Dp40L170P cells showed that the protein expression profile was modified compared to that of the control cells (PC12 Tet-On). The proteins with the highest upregulated expression were α-internexin and S100a6, which are involved in cytoskeletal structure. The expression of vesicle-associated membrane proteins increased in differentiated PC12-Dp40 cells, in contrast to PC12-Dp40L170P cells, while neurofilament light-chain was decreased in both differentiated cells. HspB1 was absent in undifferentiated cells and weakly detected in all differentiated cells. These results suggest that the subcellular distribution and expression of Dp40 has an important role in the neurite outgrowth of PC12 cells through the regulation of proteins involved in neurofilaments and exocytosis of synaptic vesicles, functions that might be affected in PC12-Dp40L170P.

show abstract

EF-hand domains are involved in the differential cellular distribution of dystrophin Dp40

Cited by 11 publications

References 23 publications

Identification of Dp71 Isoforms Expressed in PC12 Cells: Subcellular Localization and Colocalization with β-Dystroglycan and α1-Syntrophin

Identification of Dp71 Isoforms Expressed in PC12 Cells: Subcellular Localization and Colocalization with β-Dystroglycan and α1-Syntrophin

Schwann cell-specific Dp116 is expressed in glioblastoma cells, revealing two novel DMD gene splicing patterns

Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells

Contact Info

Product

Resources

About