DNA binding and meiotic chromosomal localization of the drosophila nod kinesin-like protein

Afshar, Katayoun; Barton, Nelson; Hawley, R. Scott; Goldstein, Lawrence S.B.

doi:10.1016/0092-8674(95)90377-1

Cited by 136 publications

(107 citation statements)

References 26 publications

Supporting

Mentioning

102

Contrasting

Order By: Relevance

“…In addition, the Mod and Nod proteins have also been shown to associate with bicoid mRNA and to form a complex with Swa and PABP in vivo (5). However, unlike Swa and PABP, Mod and Nod do not accumulate at the anterior cortex of the oocyte, thus implicating these proteins in the transport phase of bicoid mRNA localization (5,41,42). Therefore, the proper localization of an mRNA might be mediated by distinct transport and anchoring steps involving the remodeling of the RNP at various stages during the course of localization.…”

Section: Characterization Of the Ash1 Mrna Transport Rnpmentioning

confidence: 99%

ASH1 mRNA Anchoring Requires Reorganization of the Myo4p-She3p-She2p Transport Complex

Gonsalvez

Little

Long

2004

Journal of Biological Chemistry

View full text Add to dashboard Cite

One mechanism by which cells post-transcriptionally regulate gene expression is via intercellular and intracellular sorting of mRNA. In Saccharomyces cerevisiae, the localization of ASH1 mRNA to the distal tip of budding cells results in the asymmetric sorting of Ash1p to daughter cell nuclei. Efficient localization of ASH1 mRNA depends upon the activity of four cisacting localization elements and also upon the activity of trans-factors She2p, She3p, and Myo4p. She2p, She3p, and Myo4p have been proposed to form an ASH1 mRNA localization particle. She2p directly and specifically binds each of the four ASH1 cis-acting localization elements, whereas She3p has been hypothesized to function as an adaptor by recruiting the She2p-mRNA complex to Myo4p, a type V myosin. The Myo4p-She3p-She2p heterotrimeric protein complex has been proposed to localize mRNA to daughter cells using polarized actin cables. Here we demonstrate that whereas the predicted Myo4p-She3p-She2p heterotrimeric complex forms in vivo, it represents a relatively minor species compared with the Myo4p-She3p complex. Furthermore, contrary to a prediction of the heterotrimeric complex model for ASH1 mRNA localization, ASH1 mRNA artificially tethered to She2p is not localized. Upon closer examination, we found that mRNA tightly associated with She2p is transported to daughter cells but is not properly anchored at the bud tip. These results are consistent with a model whereby anchoring of ASH1 mRNA requires molecular remodeling of the Myo4p-She3p-She2p heterotrimeric complex, a process that is apparently altered when mRNA is artificially tethered to She2p.The establishment and maintenance of cellular polarity is a salient feature of eukaryotic cells and involves the asymmetric sorting of proteins to distinct compartments or regions of the cell. One mechanism by which proteins can be sorted in a variety of eukaryotic cell types is via mRNA localization, a process by which mRNA is specifically localized to a particular region of a cell (1-3). A primary step in the process of mRNA localization is the identification of the localization substrate by trans-acting factors, resulting in the formation of a localization mRNP. 1 The mRNP localization complexes are dynamic structures undergoing molecular reorganization at various stages of the localization pathway (4 -6). RNA localization can result from a number of distinct mechanisms involving direct transport of the mRNA to the site of localization, generalized degradation of the mRNA with localized protection or random diffusion followed by entrapment of the mRNA at the site of localization (1, 2). Ultimately, translation of the mRNA at the site of localization leads to the asymmetric distribution of the protein in the cell.The asymmetric sorting of Ash1p in Saccharomyces cerevisiae is a paradigm for investigating the asymmetric segregation of proteins via mRNA localization. Ash1p is a transcriptional repressor that is asymmetrically sorted to daughter cells, resulting in differential gene expression between mother...

show abstract

Section: Characterization Of the Ash1 Mrna Transport Rnpmentioning

confidence: 99%

ASH1 mRNA Anchoring Requires Reorganization of the Myo4p-She3p-She2p Transport Complex

Gonsalvez

Little

Long

2004

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…A putative C2H2-type zinc finger motif (Vernos et al, 1995) is also found in the amino terminus of KCBP (Figure 2). Recently some of the kinesin-like proteins have been shown to contain DNAbinding motifs (Afshar et al, 1995;Vernos et al, 1995). It has been demonstrated that kinesin-like proteins with DNAbinding motifs bind DNA and are localized on the chromosomes (Afshar et al, 1995;Vernos et al, 1995;Wang and Adler, 1995).…”

Section: Gtg'i~3atgagggaaatagtgaacaattgaacagc Ttgtt Caagc Tggtac'i~t~mentioning

confidence: 99%

A plant kinesin heavy chain‐like protein is a calmodulin‐binding protein

Reddy¹,

Narasimhulu

Safadi

et al. 1996

The Plant Journal

View full text Add to dashboard Cite

“…Genetic and molecular studies of the dominant nod mutation nod DTW and its partial revertants have demonstrated that the motor domain of NOD is critical for its function (Rasooly et al, 1991(Rasooly et al, , 1994. The genetic and cytological characterizations of NOD strongly suggest that it exerts a plateward (or antipolar) force (Rasooly et al, 1991(Rasooly et al, , 1994Theurkauf and Hawley, 1992;Afshar et al, 1995a;Karpen et al, 1996;Matthies et al, 1999) and NOD is found along the surface of meiotic chromosomes (Afshar et al, 1995a). Assuming that the polarity of MTs in the oocyte meiosis I spindle is canonical, NOD must act as either a plus-end-directed motor or as a brake.…”

Section: Introductionmentioning

confidence: 99%

Orphan Kinesin NOD Lacks Motile Properties But Does Possess a Microtubule-stimulated ATPase Activity

Matthies

Baskin

Hawley

2001

MBoC

View full text Add to dashboard Cite

NOD is a Drosophila chromosome-associated kinesin-like protein that does not fall into the chromokinesin subfamily. Although NOD lacks residues known to be critical for kinesin function, we show that microtubules activate the ATPase activity of NOD Ͼ2000-fold. Biochemical and genetic analysis of two genetically identified mutations of NOD (NOD DTW and NOD "DR2" ) demonstrates that this allosteric activation is critical for the function of NOD in vivo. However, several lines of evidence indicate that this ATPase activity is not coupled to vectorial transport, including 1) NOD does not produce microtubule gliding; and 2) the substitution of a single amino acid in the Drosophila kinesin heavy chain with the analogous amino acid in NOD results in a drastic inhibition of motility. We suggest that the microtubule-activated ATPase activity of NOD provides transient attachments of chromosomes to microtubules rather than producing vectorial transport.

show abstract

DNA binding and meiotic chromosomal localization of the drosophila nod kinesin-like protein

Cited by 136 publications

References 26 publications

ASH1 mRNA Anchoring Requires Reorganization of the Myo4p-She3p-She2p Transport Complex

ASH1 mRNA Anchoring Requires Reorganization of the Myo4p-She3p-She2p Transport Complex

A plant kinesin heavy chain‐like protein is a calmodulin‐binding protein

Orphan Kinesin NOD Lacks Motile Properties But Does Possess a Microtubule-stimulated ATPase Activity

Contact Info

Product

Resources

About