DNA Aptamers Selected against the HIV-1 RNase H Display in Vitro Antiviral Activity

Abstract

The DNA polymerase of the human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) is a target widely used to inhibit HIV-1 replication. In contrast, very few inhibitors of the RNase H activity associated with RT have been described, despite the crucial role played by this activity in viral proliferation. DNA ligands with a high affinity for the RNase H domain of HIV-1 RT were isolated by systematic evolution of ligands by an exponential enrichment strategy (SELEX), using recombinant RTs with or without the RNase H domain. The selected oligonucleotides (ODNs) were able to inhibit in vitro the HIV-1 RNase H activity, while no effect was observed on cellular RNase H. We focused our interest on two G-rich inhibitory oligonucleotides. Model studies of the secondary structure of these ODNs strongly suggested that they were able to form G-quartets. In addition to the inhibition of HIV-1 RNase H observed in a cell free system, these ODNs were able to strongly diminish the infectivity of HIV-1 in human infected cells. Oligonucleotides described here may serve as leading compounds for the development of specific inhibitors of this key retroviral enzyme activity.

Study of binding stoichiometries of the human immunodeficiency virus type 1 reverse transcriptase by capillary electrophoresis and laser‐induced fluorescence polarization using aptamers as probes

“…DNA aptamers, RT26, RT12, RT1t49, and ODN93, were selected as polymerase inhibitors of HIV-1 RT [28,29]. These aptamers, except for RTlt49, have the same 3'-GGGG structure and an internal CCCC that mimics the primer-template junction.…”

Potential uses of G-quadruplex-forming aptamers

“…Protein targeted DNA aptamers Thrombin (TBA), sensitive to fibrinogen binding site GGTTGGTGTGGTTGG Bock et al 1992;Padmanabhan et al 1993 Thrombin, sensitive to heparin binding site GGTAGGGCAGGTTGG* Tasset et al 1997 HIV integrase 93del GGGGTGGGAGGAGGGT Jing and Hogan 1998;Jing et al 2000;De Soultrait et al 2002;Phan et al 2005;Chou et al 2005 HIV-1 reverse transcriptase GGGGGTGGGAGGGTAGGCCTTAGG TTTCTGA Andreola et al 2001 HIV-1 reverse transcriptase CGCCTGATTAGCGATACTCAGCGTT GGGGGGGGGGGG Michalowski et al 2008 HIV-1 nucleocapsid protein GGTTGGTGTGGTTGG Kankia et al 2005 Anti HIV activity Unknown specific target T30177 GTGGTGGGTGGGTGGGT Mukundan et. al.…”

Aptamer-based therapeutics and their potential in radiopharmaceutical design

“…A whole series of aptamers that can bind protein targets inside and outside the cell can be found in the literature, which illustrates the potential of DNA or RNA aptamers as therapeutic modalities. Examples include aptamers to HIV related targets (Andreola et al, 2001;de Soultrait et al, 2002;Duzgunes 2001), hepatitis C (Biroccio et al, 2002;Hwang et al, 2000;Vo et al, 2003), Trypanosoma cruzi (Homann and Goringer, 1999;Homann and Goringer, 2001;Ulrich et al, 2002), prion proteins (Sayer et al, 2004;Weiss et al, 1997), thrombin (Bock et al, 1992;Griffin et al, 1993;Holland et al, 2000), anti-angiogenesis vascular endothelial growth factor (Blank et al, 2001;White et al, 2003), prostate specific membrane antigen (Lupold et al, 2002), among many others. Aptamers against the nucleolin are currently in clinical trials for the treatment of cancer with very promising results (www.antisoma.com).…”