DNA Aptamers Derived from HIV-1 RNase H Inhibitors are Strong Anti-integrase Agents

Investigation of formation, recognition, stabilization, and conversion of dimeric G-quadruplexes of HIV-1 integrase inhibitors by electrospray ionization mass spectrometry

“…T30923 and its homologue with two PT linkages, T30695, are potent integrase inhibitors. It had been shown that these G-quadruplexes can inhibit the activity of HIV-1 integrase with IC 50 values in the nanomolar range [14,15].…”

Potential uses of G-quadruplex-forming aptamers

“…Protein targeted DNA aptamers Thrombin (TBA), sensitive to fibrinogen binding site GGTTGGTGTGGTTGG Bock et al 1992;Padmanabhan et al 1993 Thrombin, sensitive to heparin binding site GGTAGGGCAGGTTGG* Tasset et al 1997 HIV integrase 93del GGGGTGGGAGGAGGGT Jing and Hogan 1998;Jing et al 2000;De Soultrait et al 2002;Phan et al 2005;Chou et al 2005 HIV-1 reverse transcriptase GGGGGTGGGAGGGTAGGCCTTAGG TTTCTGA Andreola et al 2001 HIV-1 reverse transcriptase CGCCTGATTAGCGATACTCAGCGTT GGGGGGGGGGGG Michalowski et al 2008 HIV-1 nucleocapsid protein GGTTGGTGTGGTTGG Kankia et al 2005 Anti HIV activity Unknown specific target T30177 GTGGTGGGTGGGTGGGT Mukundan et. al.…”

“…The aptamer-target complex is often more stable than an individual aptamer; recently published research shows that the TBA-thrombin complex is more stable than TBA itself (Russo Krauss et al 2012). G-quadruplex aptamers may also inhibit functions of other proteins such as HIV1-integrase (HIV1-in) (Jing and Hogan 1998;Jing et al 2000;De Soultrait et al 2002), VEGF, (Vap7) (Nonaka et al 2010) and nucleolin (AS1411) (Reyes-Reyes et al 2010). Their DNA sequences are summarized in Table 1.…”

Aptamer-based therapeutics and their potential in radiopharmaceutical design

“…A whole series of aptamers that can bind protein targets inside and outside the cell can be found in the literature, which illustrates the potential of DNA or RNA aptamers as therapeutic modalities. Examples include aptamers to HIV related targets (Andreola et al, 2001;de Soultrait et al, 2002;Duzgunes 2001), hepatitis C (Biroccio et al, 2002;Hwang et al, 2000;Vo et al, 2003), Trypanosoma cruzi (Homann and Goringer, 1999;Homann and Goringer, 2001;Ulrich et al, 2002), prion proteins (Sayer et al, 2004;Weiss et al, 1997), thrombin (Bock et al, 1992;Griffin et al, 1993;Holland et al, 2000), anti-angiogenesis vascular endothelial growth factor (Blank et al, 2001;White et al, 2003), prostate specific membrane antigen (Lupold et al, 2002), among many others. Aptamers against the nucleolin are currently in clinical trials for the treatment of cancer with very promising results (www.antisoma.com).…”