DivS, a novel SOS‐inducible cell‐division suppressor in <i>Corynebacterium glutamicum</i>

Ogino, Hiroyasu; Teramoto, Haruhiko; Inui, Masayuki; Yukawa, Hideaki

doi:10.1111/j.1365-2958.2007.06069.x

Cited by 54 publications

(65 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For several bacteria the products of a number of SOS-response genes have been found to inhibit this process. Such genes include sulA for E. coli (Huisman et al, 1984), yneA for B. subtilis (Kawai et al, 2003), Rv2719c for Mycobacterium tuberculosis (Chauhan et al, 2006), and divS for Corynebacterium glutamicum (Ogino et al, 2008). These studies reported the occurrence of cell elongation as a consequence of the SOS response.…”

Section: Discussionmentioning

confidence: 85%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

show abstract

Section: Discussionmentioning

confidence: 85%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

show abstract

“…The lexA gene (cg2114) of C. glutamicum ATCC 13032 is located in a head-to-head arrangement with the divS-nrdR (cg2113-cg2112) transcription unit (Fig. 1a), encoding a cell division suppressor and a regulator of deoxyribonucleotide biosynthesis (Borovok et al, 2004;Ogino et al, 2008;Rodionov & Gelfand, 2005). Downstream of the nrdR gene, a coding region for a putative ATP-dependent helicase has been predicted ( Fig.…”

Section: Resultsmentioning

confidence: 99%

“…The remaining genes encode hypothetical proteins with unknown functions, including secreted proteins, putative membrane proteins and potential transporters (Tables 2, 3 and 4). The only regulatory genes directly controlled by the LexA protein are lexA itself and the divergently oriented divS and nrdR genes, encoding a regulator of cell division and a DNA binding transcription regulator of ribonucleotide reductase, respectively (Borovok et al, 2004;Ogino et al, 2008;Rodionov & Gelfand, 2005). Interestingly, the three regulatory genes are located in a highly conserved gene region of the hitherto sequenced corynebacterial genomes (Fig.…”

Section: Verification Of Differential Gene Expression By Rt-pcr and Dmentioning

confidence: 99%

“…1). Promoter mapping data suggested that three SOS boxes are used for autoregulation of lexA, while the fourth LexA binding site is involved in controlling expression of the cell division suppressor gene divS (Ogino et al, 2008) and the nrdR gene, which encodes a regulator of deoxyribonucleotide biosynthesis (Brune et al, 2005). Likewise, four potential LexA binding sites have been detected upstream of the lexA coding region in M. tuberculosis, but only one of these SOS boxes is required for regulation of lexA transcription .…”

Section: Is Lexa Involved In Transcriptional Activation Of Sos Gene Ementioning

confidence: 99%

See 1 more Smart Citation

Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays

et al. 2009

View full text Add to dashboard Cite

The lexA gene of Corynebacterium glutamicum ATCC 13032 was deleted to create the mutant strain C. glutamicum NJ2114, which has an elongated cell morphology and an increased doubling time. To characterize the SOS regulon in C. glutamicum, the transcriptomes of NJ2114 and a DNA-damage-induced wild-type strain were compared with that of a wild-type control using DNA microarray hybridization. The expression data were combined with bioinformatic pattern searches for LexA binding sites, leading to the detection of 46 potential SOS boxes located upstream of differentially expressed transcription units. Binding of a hexahistidyl-tagged LexA protein to 40 double-stranded oligonucleotides containing the potential SOS boxes was demonstrated in vitro by DNA band shift assays. It turned out that LexA binds not only to SOS boxes in the promoteroperator region of upregulated genes, but also to SOS boxes detected upstream of downregulated genes. These results demonstrated that LexA controls directly the expression of at least 48 SOS genes organized in 36 transcription units. The deduced genes encode a variety of physiological functions, many of them involved in DNA repair and survival after DNA damage, but nearly half of them have hitherto unknown functions. Alignment of the LexA binding sites allowed the corynebacterial SOS box consensus sequence TcGAA(a/c)AnnTGTtCGA to be deduced. Furthermore, the common intergenic region of lexA and the differentially expressed divS-nrdR operon, encoding a cell division suppressor and a regulator of deoxyribonucleotide biosynthesis, was characterized in detail. Promoter mapping revealed differences in divS-nrdR expression during SOS response and normal growth conditions. One of the four LexA binding sites detected in the intergenic region is involved in regulating divS-nrdR transcription, whereas the other sites are apparently used for negative autoregulation of lexA expression.

show abstract

“…A DNA fragment containing the promoter region of the bglF2 gene of C. glutamicum strain R was amplified by PCR using the primer pair PbglF2-F and PbglF2-R (supplemental Table S1) and was cloned between the EcoRI and SacI sites of a shuttle vector, pCRC500 (20), to construct pCRC531. DNA fragments containing the qorR coding region were excised from pCRD610 and pCRD611 (see below) with NdeI and HindIII and cloned between the NdeI and HindIII sites of pCRC531 to construct pCRD630 and pCRD631, respectively.…”

mentioning

confidence: 99%

Regulation of Quinone Oxidoreductase by the Redox-sensing Transcriptional Regulator QorR in Corynebacterium glutamicum

Ehira

Ogino

Teramoto

et al. 2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Corynebacterium glutamicum cgR_1435 (cg1552) encodes a protein of the DUF24 protein family, which is a novel family of transcriptional regulators. CgR1435 (QorR) is a negative regulator of cgR_1436 (qor2), which is located upstream of cgR_1435 (qorR) in the opposite orientation, and its structural gene. QorR binds to the intergenic region between qor2 and qorR to repress their expression, which is induced by the thiol-specific oxidant diamide. The DNA-binding activity of QorR is impaired by oxidants such as diamide, H 2 O 2 , and cumene hydroperoxide in vitro, and its lone cysteine residue (Cys-17) is essential for redox-responsive regulation of QorR activity both in vivo and in vitro. Moreover, a disruptant of qor2, which is a homologue of the ytfG gene of Escherichia coli encoding quinone oxidoreductase, shows increased sensitivity to diamide. It is concluded that the redox-sensing transcriptional regulator QorR is involved in disulfide stress response of C. glutamicum by regulating qor2 expression.

show abstract

DivS, a novel SOS‐inducible cell‐division suppressor in Corynebacterium glutamicum

Cited by 54 publications

References 46 publications

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays

Regulation of Quinone Oxidoreductase by the Redox-sensing Transcriptional Regulator QorR in Corynebacterium glutamicum

Contact Info

Product

Resources

About