Diverse point mutations result in glucose-6-phosphate dehydrogenase (G6PD) polymorphism in Taiwan

Abstract

Glucose-6-PHOSPHATE dehydrogenase (G6PD; EC 1.1.1.49) deficiency is the most common human enzymopathy, affecting more than 200 million people worldwide. Although greater than 400 variants have been described based on clinical and biochemical criteria, little is known about the molecular basis of these G6PD deficiencies. Recently, the gene that encodes human G6PD has been cloned and sequenced, which enables us to examine directly the heterogeneity of G6PD at the DNA level. During the past 10 years, we examined the G6PD activity in 21,271 newborn Chinese infants (11,400 males and 9,871 females) and identified 314 (2.8%) males and 246 (2.5%) females having low G6PD activity. The G6PD gene from 10 randomly selected affected individuals and their relatives was polymerase chain reaction (PCR) amplified, subcloned, and sequenced. Our results indicate that at least four types of mutation are responsible for the G6PD polymorphism in Taiwan. The first type of mutation (487 G----A) was found in an affected Chinese with a G to A change at nucleotide 487, which results in a (163)Gly to Ser substitution. The second type of mutation (493 A----G) is a novel mutation that has not been reported in any other ethnic group and was identified in two affected Chinese. This mutation causes an A to G change at nucleotide position 493, producing an (165)Asn to Asp substitution. Interestingly, the 487 G----A and 493 A----G mutations create Alu I and Ava II recognition sites, respectively, which enabled us to rapidly detect these two mutations by PCR/restriction enzyme (RE) digestion method. The third mutation (1376 G----T) was found in four affected Chinese. This mutation causes a G to T change at nucleotide position 1376 that results in an (459)Arg to Leu substitution. The 1376 G----T mutation seems to be the dominant allele that causes G6PD deficiency in Taiwan. Finally, two affected Chinese were identified as having the fourth mutation (1388 G----A). This mutation causes a G to A change at nucleotide 1388 that produces an (463)Arg to His substitution. Our studies provide the direct proof of the genetic heterogeneity of G6PD deficiency in the Chinese populations of Taiwan and the PCR/RE digestion method is suitable for simultaneous detection of the 487 G----A and 493 A----G mutations.

Recurrent BRCA1 and BRCA2 germline mutations in ovarian cancer: A founder mutation of BRCA1 identified in the Chinese population

“…This observation supports previous publications suggesting Southern Chinese have distinctive genetic characteristics from that of the Northern Chinese. Studies on glucose-6-phosphate dehydrogenase deficiency, Thalassemia and debrisoquin hydroxylation phenotype have reported the finding of genetic variation amongst Chinese subjects from different regions (Wang et al, 1993;Tang et al, 1992;Tang et al, 1993;Liu et al, 1997). Tang et al 1999 have also identified a recurrent BRCA1 mutation 589-590delCT related to early onset breast cancer in 3 unrelated patients of Southern Chinese origin.…”

A Population Survey of the Glucose-6-Phosphate Dehydrogenase (G6PD) 563C>T (Mediterranean) Mutation in Afghanistan

“…In order to study polymorphic markers relevant to the Asian setting (1311C>T [18] and IVSXI C93T [19] , Table 1 ), in all samples with 563C>T and a subset of samples wild-type at C563, PCR and sequencing of exons 11 and 12 including introns 11 and 12 was undertaken using the protocol of Tang et al [20] ; the forward primer was GAAGCCGGGCATGTTCTTCAAC and the reverse CCAGGGCTCAGAGCTTGTG . All amplification fragments spanning exons 11 and 12 were subjected to gel electrophoresis and purified using FavorPrep™ GEL/PCR Purification kit (Favorgen, Austria).…”

Frequency of Mediterranean mutation among a group of Saudi G6PD patients in Western region‐Jeddah

“…The recent advances in techniques have allowed an accurate molecular characterization of the G6PD gene and a number of variants have been identified (Beutler, 1991). The abnormalities for G6PD deficiency have also extended to ethnic groups in Asia, China (Chang et al, 1992;Tang et al, 1992;Chiu et al, 1993;Lo et al, 1994;Xu et al, 1995;Ainoon et al, 1999), Taiwan (Tang et al, 1995), Indonesia (Soemantri et al, 1995), and Southeast Asia (Iwai et al, 2001). There are reports for population-based studies on G6PD heterogeneity in Middle East.…”