Discovery of a fourth evolutionary lineage of Phytophthora ramorum: EU2

Poucke, Kris Van; Franceschini, S.; Webber, Joan; Vercauteren, Annelies; Turner, Judith A.; McCracken, A. R.; Heungens, Kurt; Brasier, C. M.

doi:10.1016/j.funbio.2012.09.003

Cited by 80 publications

(79 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…One allele closely resembles the other P. ramorum alleles while the second allele more closely resembles the P. lateralis ortholog. The recently reported EU2 lineage is homozygous for this second allele [36]. Thus, PrAvh121 exhibits transpecific polymorphism and recombination.…”

Section: Resultsmentioning

confidence: 98%

“…These lineages have been estimated to be relatively old, such that they evolved in isolation prior to introduction to North America and Europe [35]. In 2011, a fourth diverged clonal lineage was discovered in the United Kingdom [36]. There is some evidence for phenotypic variation among lineages including differences in colony morphology, growth rates, and pathogenicity [37,38].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Evolution of RXLR-Class Effectors in the Oomycete Plant Pathogen Phytophthora ramorum

2013

View full text Add to dashboard Cite

Phytophthora plant pathogens contain many hundreds of effectors potentially involved in infection of host plants. Comparative genomic analyses have shown that these effectors evolve rapidly and have been subject to recent expansions. We examined the recent sequence evolution of RXLR-class effector gene families in the sudden oak death pathogen, P. ramorum. We found that P. ramorum RXLR effectors have taken multiple evolutionary paths, including loss or gain of repeated domains, recombination or gene conversion among paralogs, and selection on point mutations. Sequencing of homologs from two subfamilies in P. ramorum’s closest known relatives revealed repeated gene duplication and divergence since speciation with P. lateralis. One family showed strong signatures of recombination while the other family has evolved primarily by point mutation. Comparison of a small number of the hundreds of RXLR-class effectors across three clonal lineages of P. ramorum shows striking divergence in alleles among lineages, suggesting the potential for functional differences between lineages. Our results suggest future avenues for examination of rapidly evolving effectors in P. ramorum, including investigation of the functional and coevolutionary significance of the patterns of sequence evolution that we observed.

show abstract

Section: Resultsmentioning

confidence: 98%

Section: Introductionmentioning

confidence: 99%

Evolution of RXLR-Class Effectors in the Oomycete Plant Pathogen Phytophthora ramorum

2013

View full text Add to dashboard Cite

show abstract

“…The PCR was based on the protocols developed by Van Poucke et al . (), but with modifications. All PCR was set up on ice in 20 μ L reaction volumes, each containing 10 μ L REDTaq ReadyMix (2 × concentrate; Sigma Aldrich), 1 μ L each of 10 μ m stocks of primers Cox1F1 (5′‐GTATTATTAGTCAAGTTTCTGCAGC‐3′) and Cox1R1 (5′‐CTTACAGCATTCCAACCACTCA‐3′), 3 μ L sterile distilled water, and 5 μ L unquantified genomic DNA.…”

Section: Methodsmentioning

confidence: 99%

In planta detection used to define the distribution of the European lineages of Phytophthora ramorum on larch (Larix) in the UK

2015

View full text Add to dashboard Cite

Two genetically distinct evolutionary lineages of the oomycete pathogen Phytophthora ramorum are responsible for the major epidemic on larch (Larix spp.) in the UK: EU1 (historically widespread) and the recently identified EU2 (reported only from Northern Ireland and a small area in southwest Scotland). Methods for lineage discrimination have required pure cultures of P. ramorum but, as the pathogen is challenging to isolate from infected larch tissue, only limited data have been available on the distribution of EU2. In this study a protocol was developed to determine the lineage of P. ramorum in infected larch tissue without the need for isolation. The protocol was applied to 134 UK samples collected during 2013–14. In addition, lineage testing was applied to over 300 P. ramorum isolates cultured from a wide range of hosts between 2002 and 2012. Combined data confirmed that EU2 is restricted to Northern Ireland and a small area of southwest Scotland where it is the dominant lineage. There was no evidence of EU2 spread into England and Wales where only EU1 was found. However, EU2 was more widely distributed in southern and eastern parts of Scotland than previously reported. Furthermore, EU1 and EU2 were detected <10 km apart in larch plantations. This study provides the first reports of natural EU2 infection on European larch (Larix decidua), hybrid larch (Larix × eurolepis), beech (Fagus sylvatica), noble fir (Abies procera) and western hemlock (Tsuga heterophylla).

show abstract

“…P. infestans has more than 18 reported clonal lineages (Hu et al, 2012), while P. ramorum has 4 reported clonal lineages (Grünwald et al, 2009; Van Poucke et al, 2012). To establish a database with a wide representation of clonal lineages in each species, we obtained and prepared DNA samples from P. infestans and P. ramorum that were collected from various regions of the world.…”

Section: Introductionmentioning

confidence: 99%

Microbe-ID: an open source toolbox for microbial genotyping and species identification

Tabima

Everhart

Larsen

et al. 2016

PeerJ

View full text Add to dashboard Cite

Development of tools to identify species, genotypes, or novel strains of invasive organisms is critical for monitoring emergence and implementing rapid response measures. Molecular markers, although critical to identifying species or genotypes, require bioinformatic tools for analysis. However, user-friendly analytical tools for fast identification are not readily available. To address this need, we created a web-based set of applications called Microbe-ID that allow for customizing a toolbox for rapid species identification and strain genotyping using any genetic markers of choice. Two components of Microbe-ID, named Sequence-ID and Genotype-ID, implement species and genotype identification, respectively. Sequence-ID allows identification of species by using BLAST to query sequences for any locus of interest against a custom reference sequence database. Genotype-ID allows placement of an unknown multilocus marker in either a minimum spanning network or dendrogram with bootstrap support from a user-created reference database. Microbe-ID can be used for identification of any organism based on nucleotide sequences or any molecular marker type and several examples are provided. We created a public website for demonstration purposes called Microbe-ID (microbe-id.org) and provided a working implementation for the genus Phytophthora (phytophthora-id.org). In Phytophthora-ID, the Sequence-ID application allows identification based on ITS or cox spacer sequences. Genotype-ID groups individuals into clonal lineages based on simple sequence repeat (SSR) markers for the two invasive plant pathogen species P. infestans and P. ramorum. All code is open source and available on github and CRAN. Instructions for installation and use are provided at .

show abstract

Discovery of a fourth evolutionary lineage of Phytophthora ramorum: EU2

Cited by 80 publications

References 52 publications

Evolution of RXLR-Class Effectors in the Oomycete Plant Pathogen Phytophthora ramorum

Evolution of RXLR-Class Effectors in the Oomycete Plant Pathogen Phytophthora ramorum

In planta detection used to define the distribution of the European lineages of Phytophthora ramorum on larch (Larix) in the UK

Microbe-ID: an open source toolbox for microbial genotyping and species identification

Contact Info

Product

Resources

About