Development of expressed sequence tag derived-simple sequence repeats in the genus Lilium

Abstract

Although lily is the second largest flower crop in cutting flower commodity, only six simple sequence repeats SSRs have been reported. Thus, we developed expressed sequence tag derived-SSRs (EST-SSRs) for the Lilium genus. Among 2,235 unique ESTs, 754 ESTs contained SSR motifs, among which 165 ESTs were amenable to primer design. Among these 165 EST-SSRs, 131 EST-SSRs showed amplification in at least one Lilium species, and 76 EST-SSRs showed amplification in at least nine species. Of the 76 EST-SSRs, 47 showed amplification in all Lilium species analyzed. Using 10 breeding lines, we selected 19 EST-SSRs that had the highest number of alleles and polymorphism information content. The polymorphism information content values of these selected EST-SSRs ranged from 0.49 to 0.94 with an average of 0.76, which are higher than other plant species. The phylogenetic dendrogram derived from the amplification profiles of the 19 high polymorphic EST-SSRs was congruent with the genetic background of the 84 selected lily accessions and hybrids, which are available in commerce. Thus, the developed EST-SSRs will be very useful in germplasm management, genetic diversity analysis, cultivar finger printing, and molecular breeding in the lily.

Cloning and characterization of a benzoic acid/salicylic acid carboxyl methyltransferase gene involved in floral scent production from lily (Lilium ‘Yelloween’)

“…Lily is one of the most popular cut flowers and plays a central role in the flower market worldwide (Lee et al, 2011). After floral color and shape, fragrance is another major characteristic of ornamental lily.…”

Morphological and Simple Sequence Repeat Analysis to Clarify the Diversity of Natural <i>Lilium japonicum</i> and <i>L. auratum</i> Hybrids in the Hybrid Zone of the Izu Peninsula, Japan

“…Seven EST-SSR markers (L20, L59, eL16, ivflmre252, ivflmre294, ivflmre330, and ivflmre850) were selected from the studies of Lee et al (2011) and Yuan et al (2013) (Table 2). Polymerase chain reaction (PCR) was performed in reaction mixtures containing 0.4 μL of deoxyribonucleoside triphosphate (dNTP) mix, 0.5 μL of 10 × reaction buffer, 0.3 μM each of forward and reverse primer pairs, 0.025 μL of Ex Taq polymerase (Takara, Tokyo, Japan), 20 ng of DNA, and sterile distilled water in a final volume of 5 μL.…”

“…PCR amplification was performed using a T100 thermal cycler (BioRad, Hercules, CA, USA). For the L20, L59, and eL16 markers, the reaction cycles consisted of an initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, followed by a final extension step at 72°C for 5 min (Lee et al, 2011). For the ivflmre252, ivflmre294, ivflmre330, and ivflmre850 markers, a touchdown PCR amplification was performed with the following reaction cycles: denaturation at 94°C for 5 min, followed by 10 cycles of denaturation at 94°C for 30 s, annealing at 63°C for 30 s (reducing by 0.5°C in each cycle), and extension at 72°C for 45 s. Subsequently, PCR was performed with 25 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 45 s, followed by a final extension at 72°C for 5 min (Yuan et al, 2013).…”

“…Morphological characteristics of these populations were more similar Table 2. Primer sequences of SSR markers (Lee et al, 2011;Yuan et al, 2013) Yuan et al (2013) ivflmre294 TTGGCGGTTGATCTTGTTCT TGCAACCCTTTTCTCTCCTC 145-168 12 0.589 Yuan et al (2013) ivflmre330 AGCACCACCACTGTCTTTATCG ATCTCCTCGTTGTTCGGGTT 225-234 4 0.651 Yuan et al (2013) ivflmre850 GCAGCGAGTGCGACAAAG AGATCTGGTCATCAGGAGCG 227-239 7 0.670 Yuan et al (2013) z Na: Number of alleles. y He: Expected heterozygosity.…”

“…Expressed sequence tag (EST)-SSR markers applicable for evaluation of genetic diversity and identity in the Lilium genus have recently been developed. Lee et al (2011) Table 1.…”