Detection of contaminants in cell cultures, sera and trypsin

Oliveira, Tatiana Flávia Pinheiro de; Fonseca, Antônio Augusto; Camargos, Marcelo Fernandes; Oliveira, Anapolino Macedo de; Cottorello, Ana Cláudia Pinto; Souza, Antonizete dos Reis; Almeida, Iassudara Garcia de; Heinemann, Marcos Bryan

doi:10.1016/j.biologicals.2013.08.005

Cited by 70 publications

(42 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The examination was carried out using a PCR method reported previously (Vilcek et al 1994, Pinheiro de Oliveira et al 2013. The primer pair for the PCR was as follows: forward (ATGCCCWTAGTAGGACTAGCA; position 108-128) and reverse (TCAACTCCATGTGCCATGTAC; position 395-375) with an expected product size of 288 bp, which are the highly conserved 5′ non-coding/non-structural coding regions of the pestivirus BVDV genome strain NADL (Vilcek et al 1994).…”

Section: Bvdv Test For Experimental Samplesmentioning

confidence: 99%

BVDV alters uterine prostaglandin production during pregnancy recognition in cows

Cheng¹,

Abudureyimu²,

Oguejiofor³

et al. 2016

Reproduction

View full text Add to dashboard Cite

Embryonic mortality in cows is at least in part caused by failure of pregnancy recognition (PR). Evidence has shown that bovine viral diarrhoea virus (BVDV) infection can disrupt pregnancy. Prostaglandins (PG) play important roles in many reproductive processes, such as implantation. The aim of this study was to investigate the effect of BVDV infection on uterine PG production and PR using an in vitro PR model. Bovine uterine endometrial cells isolated from ten BVDV-free cows were cultured and treated with 0 or 100 ng/mL interferon-τ (IFNT) in the absence or presence of non-cytopathic BVDV (ncpBVDV). PGF 2α and PGE 2 concentrations in the spent medium were measured using radioimmunoassays, and in the treated cells expression of the genes associated with PG production and signalling was quantified using qPCR. The results showed that the IFNT challenge significantly stimulated PTGS1 and PTGER3 mRNA expression and PGE 2 production; however, these stimulatory effects were neutralised in the presence of ncpBVDV infection. ncpBVDV infection significantly increased PTGS1 and mPGES1 mRNA expression and decreased AKR1B1 expression, leading to increased PGE 2 and decreased PGF 2α concentrations and an increased PGE 2 :PGF 2α ratio. The other tested genes, including PGR, ESR1, OXTR, PTGS2, PTGER2 and PTGFR, were not significantly altered by IFNT, ncpBVDV or their combination. Our study suggests that BVDV infection may impair PR by (1) inhibiting the effect of IFNT on uterine PG production and (2) inducing an endocrine switch of PG production from PGF 2α to PGE 2 to decrease uterine immunity, thereby predisposing the animals to uterine disease.Reproduction (2016) 151 605-614

show abstract

Section: Bvdv Test For Experimental Samplesmentioning

confidence: 99%

BVDV alters uterine prostaglandin production during pregnancy recognition in cows

Cheng¹,

Abudureyimu²,

Oguejiofor³

et al. 2016

Reproduction

View full text Add to dashboard Cite

show abstract

“…Viruses were grown in PK15 cells and DNA extracted as described by FONSECA JR et al (2010b) (Group 1). All cells were previously tested for contamination (PPV, PCV-2, Mycoplasma, BVDV) as described by PINHEIRO de OLIVEIRA et al (2013).…”

Section: Methodsmentioning

confidence: 99%

Different methods of real-time PCR for detection of pseudorabies virus

et al. 2017

Self Cite

View full text Add to dashboard Cite

Pseudorabies (PR) is a highly contagious viral disease of great animal health and economic importance in swine industry. The aim of this study was to evaluate different genomic regions, real-time PCR chemistries and equipment for the molecular diagnosis of PR. Eight primer pairs targeting four genes (gB, gC, gE, gD), three different qPCR chemistries (SybrGreen, hydrolysis probes and plexor) and two equipment (ABI7500, Rotorgene 3000) were evaluated. Oligonucleotides targeting gB using hydrolysis probes showed the best performance after evaluating efficiency (99%), the detection limit (10-1.5 TCID50 mL-1) and diagnostic sensitivity and; therefore, those primers were selected for performance verification factors such as repeatability, reproducibility and robustness (1.39% variance between days, 24% variance between analysts and 4.07% variance in analysis error). The qPCR standardized and validated in this research proved to be reliable for the diagnosis of PR and may be used in diagnostic laboratories that follow ISO 17025 and ISO 16140.

show abstract

“…40 They were believed to have cytadherence ability but some species (M. genitalium, M. pneumoniae, M. penetrans) have been noted intracellularly too. 41 During mycoplasma infection, a cell line undergoes either severe or very little cytopathological change, depending upon the type of mycoplasma contamination. The cellular protein, and DNA and RNA synthesis gets altered along with cellular metabolism causing changes in cell membrane composition.…”

Section: The Effect Of Microbial Contamination On Cell Linesmentioning

confidence: 99%

Microbial and Viral Contamination of Animal and Stem Cell Cultures: Common Contaminants, Detection and Elimination

Mahmood

Ali

2017

JSRT

View full text Add to dashboard Cite

The microbial contamination of animal cell culture, including stem cells, such as the blood stem cells, is a common problem of cell culture laboratories. It is important to identify the types of microorganisms commonly contaminating the cell culture and the sources of contaminating microorganisms, as well as see their effects on cells in culture. This mini review provides a short account of common microbial contaminations of stem cell and animal cell cultures, their detection and elimination, as well as standard practices to ensure a healthy and sterile cell culture, and a brief account of methods used for identification of contaminating microorganisms in cell culture. spoil a culture medium. Keywords7 Residues from germicides used to disinfect incubators, equipments and labs, and impurities in gases used in CO 2 incubators have also been found to affect cell culture.8 However, the major source of microbial contamination is documented to arise by contact with non-sterile supplies, media and solution, chemicals and equipments, and by the particulate matter and aerosols that fall out during transportation and incubation.9 According to a study, 1960-70, the new born bovine serum obtained from commercial suppliers was found to be a major source of bacterial, particularly the mycoplasma, contamination. 10One of the most common contaminants, and also difficult to detect, that has been reported in literature is Mycoplasma contamination. 11Mycoplasma is an intracellular bacterium that may go unnoticed for many passages. Its presence can change several cell properties such as the growth, metabolism, morphology, and genome structure. In literature, the incidences of Mycoplasma contamination have been reported over a period of time since 1956. 12 The incidence of Mycoplasma contamination was 19%, as compared with fungal (8%) and other bacterial (4%) contaminations. The contamination is reported to spread through airborne particles and non-sterile surfaces mainly. 13 In a study on fibroblasts and keratinocyte cell lines, 32.35% cultures were contaminated, and among these, the mycoplasma contaminated cultures were 17.65%, followed by fungal (8.82%) and bacterial (5.88%) contaminants.14 Aspergillus tops the list of fungal contamination of cell cultures. 15M. orale is reported to be the most common contamination that can spread from human oral cavity, and hence making the lab workers a major source of this contamination.10 Bacterial species (Bacillus sp., Enterococcus sp. and Staphylococcus sp) are similarly some major contaminants of animal cell cultures.9 A list of common microbial species and their major sources that have been reported to contaminate animal/stem cell culture is provided in Table 1 & 2, respectively.

show abstract

Detection of contaminants in cell cultures, sera and trypsin

Cited by 70 publications

References 32 publications

BVDV alters uterine prostaglandin production during pregnancy recognition in cows

BVDV alters uterine prostaglandin production during pregnancy recognition in cows

Different methods of real-time PCR for detection of pseudorabies virus

Microbial and Viral Contamination of Animal and Stem Cell Cultures: Common Contaminants, Detection and Elimination

Contact Info

Product

Resources

About