Design and evaluation of a unique SYBR Green real-time RT-PCR assay for quantification of five major cytokines in cattle, sheep and goats

Abstract

BackgroundToday, when more than 60% of animal diseases are zoonotic, understanding their origin and development and identifying protective immune responses in ruminants are major challenges. Robust, efficient and cost-effective tools are preconditions to solve these challenges. Cytokines play a key role in the main mechanisms by which the immune system is balanced in response to infectious pathogens. The cytokine balance has thus become the focus of research to characterize immune response in ruminants. Currently, SYBR Green reverse transcriptase quantitative PCR (RT-qPCR) is the most widely method used to investigate cytokine gene expression in ruminants, but the conditions in which the many assays are carried out vary considerably and need to be properly evaluated. Accordingly, the quantification of gene expression by RT-qPCR requires normalization by multiple reference genes. The objective of the present study was thus to develop an RT-qPCR assay to simultaneously quantify the expression of several cytokines and reference genes in three ruminant species. In this paper, we detail each stage of the experimental protocol, check validation parameters and report assay performances, following MIQE guidelines.ResultsTen novel primer sets were designed to quantify five cytokine genes (IL-4, IL-10, IL-12B, IFN-γ and TNF-α) and five reference genes (ACTB, GAPDH, H3F3A, PPIA and YWHAZ) in cattle, sheep, and goats. All the primer sets were designed to span exon-exon boundaries and use the same hybridization temperature. Each stage of the RT-qPCR method was detailed; their specificity and efficiency checked, proved and are reported here, demonstrating the reproducibility of our method, which is capable of detecting low levels of cytokine mRNA up to one copy whatever the species. Finally, we checked the stability of candidate reference gene expression, performed absolute quantification of cytokine and reference gene mRNA in whole blood samples and relative expression of cytokine mRNA in stimulated PBMC samples.ConclusionsWe have developed a novel RT-qPCR assay for the simultaneous relative quantification of five major cytokines in cattle, sheep and goats, and their accurate normalization by five reference genes. This accurate and easily reproducible tool can be used to investigate ruminant immune responses and is widely accessible to the veterinary research community.Electronic supplementary materialThe online version of this article (doi:10.1186/s12917-015-0382-0) contains supplementary material, which is available to authorized users.

Change in the responsiveness of interferon-stimulated genes during early pregnancy in cows with Borna virus-1 infection

“…The expression of ISG15 and Mx2 genes was examined using quantitative RT-PCR (LightCycler® FastStart DNA Master SYBR Green I, Roche); the gene expression was normalized to GAPDH [19]. The primer pairs for the detection of the genes are as follows—ISG15 (NM_174366) forward: GGTATCCGAGCTGAAGCAGTT, reverse: ACCTCCCTGCTGTCAAGGT (131–217, 86 bp); Mx2 (NM_173941) forward: CTTCAGAGACGCCTCAGTCG, reverse: TGAAGCAGCCAGCAATAGTG (2071–2302, 231 bp); and GAPDH (XR_082746) forward: GATTGTCAGCAATGCCTCCT, reverse: GGTCATAAGTCCCTCCACGA (546–638, 92 bp).…”

Immunomodulatory effects ofEchinaceaandPelargoniumon the innate and adoptive immunity in calves

“…The amount and duration of these herbs were tested in this study by using a different amount of CEVASTIM in different durations. The method, real-time RT-PCR to estimate cytokine expression levels used in this study was also used by many investigators (Dapas et al, 2014;Konnai et al, 2003;Puech, Dedieu, Chantal, & Rodrigues, 2015). Results of previous studies have indicated that cytokine gene expression usually increases after 72-96 hours of immunization (Dar, Hajam, Suryanarayana, Kishore, & Kondabattula, 2015).…”

Effect of Mycoplasma bovis on Production of Pro-Inflammatory Cytokines by Peripheral Blood Mononuclear Cells

“…YWHAZ codes for Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide and was earlier reported to be a suitable reference gene for bovine samples (Spalenza et al, 2011). Previously reported primers which bind at the exon-exon junctions were used in this study (Yamada et al, 2009;Puech et al, 2015). Group I represents bovine PBMC treated with live M. bovis at MOI of 100:1 and group II represents untreated control.…”