Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1

Abstract

Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

Phenotypic characterization of virological failure following lopinavir/ritonavir monotherapy using full-length gag-protease genes

“…26,28 Clonal sequence analysis of 10 viral variants for each sample was performed in MEGA 5.0 software using ClustalW. The variant that most closely represented the consensus for each timepoint was selected for phenotypic testing, along with other variants of interest.…”

“…Identification of broad genotypic predictors of PI susceptibility using Gag–protease remains elusive, most probably due to the importance of coevolution of residues on individual Gag sequences. 23,24 The inclusion of full-length patient-derived Gag alongside its coevolved protease in in vitro phenotypic assays has been shown to substantially affect PI susceptibility (as compared with the use of protease sequences alone) in patients not exposed to PI 25,26 and in a heavily treated patient with multiple major resistance mutations in protease. 27 There are no data using this method for the most relevant clinical application: assessment of susceptibility to PI following failure of this class of drug (when major mutations in protease are not detected by standard population sequencing-based methods).…”

Transient HIV-1 Gag–protease interactions revealed by paramagnetic NMR suggest origins of compensatory drug resistance mutations

“…The regions of Gag and protease that undergo compensatory mutations are strikingly similar to those exhibiting significant intermolecular PREs, thereby providing a plausible underlying structural basis behind these mutations. For example, conservative noncleavage site mutations in MA, specifically K30R, R76K, Y79F, and T81A, restore the fitness deficit arising from drug-resistant protease by improving replication capacity and generating a significant reduction in susceptibility to protease inhibitors in vivo (14,29). These residues along with two other drug-resistance mutations, E12K and L75R, reside in regions of MA that give large intermolecular PREs.…”

Genetic Changes in HIV-1 Gag-Protease Associated with Protease Inhibitor-Based Therapy Failure in Pediatric Patients

“…A 1.8-kb Gag-PR fragment spanning HXB2 positions 792 to 2549 was amplified by nested polymerase chain reaction (PCR) using an Expand High Fidelity PCR kit (Roche Applied Science, Basel, Switzerland) as previously descibed. 23 Primers BKT03 (5¢ CGCAGGA CTCGGCTTGC 3¢) and ProOutR (5¢ TTGGGCCATCCA TTCCTGG 3¢) were used for first round PCR and primers GagNot + (5¢ GCGGCGGCCGCAAGGAGAGAGATGGG TGCG 3¢) and ProXhoR2 (5¢ CTGGTACAGTCTCGAG RGGACTRATKGG 3¢) for nested PCR. Population-based sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA) on an ABI3130 Genetic Analyzer (Applied Biosystems, Foster City, CA).…”