Construction of an sIgE:FLAG-mIgE:GFP Reporter Mouse Strain

Achatz‐Straussberger, Gertrude; Geisberger, Roland; Oberndorfer, Iris; Inführ, Daniela; Luger, Elke; Fallon, Padraic G.; Lamers, Marinus C.; Achatz, Gernot

doi:10.1159/000070215

Cited by 2 publications

(3 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For positive selection a neomycin resistance gene, expressed by a thymidine kinase promoter (Tk-NEO), was inserted. BALB/c ES cells for gene targeting were transfected with 30 μg of linearized target vector and cultured and selected as described before [15, 31]. Resistant clones were screened by nested PCR with primer combination 257–258 and 259–260: 257: 5′AGTTGGCCTTTTCTGGGTTCT3′258: 5′ATGGCCGCTTTTCTGGATTC3′259: 5′CAACTACGCCCCGGAGCCATCAG3′260: 5′CGCATCGCCTTCTATCG3′…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Migration of antibody secreting cells towards CXCL12 depends on the isotype that forms the BCR

et al. 2008

Self Cite

View full text Add to dashboard Cite

Truncation of the cytoplasmic tail of membrane-bound IgE in vivo results in lower serum IgE levels, decreased numbers of IgE-secreting plasma cells and the abrogation of specific secondary immune responses. Here we present mouse strain KN1 that expresses a chimeric e-c1 BCR, consisting of the extracellular domains of the e gene and the transmembrane and cytoplasmic domains of the c1 gene. Thus, differences in the IgE immune response of KN1 mice reflect the influence of the ''c1-mediated signalling'' of mIgE bearing B cells. KN1 mice show an increased serum IgE level, resulting from an elevated number of IgE-secreting cells. Although the primary IgE immune response in KN1 mice is inconspicuous, the secondary response is far more robust. Most strikingly, IgE-antibody secreting cells with ''c1-signalling history'' migrate more efficiently towards the chemokine CXCL12, which guides plasmablasts to plasma cell niches, than IgE-antibody secreting cells with WT ''e-signalling history''. We conclude that IgE plasmablasts have an intrinsic, lower chance to contribute to the long-lived plasma cell pool than IgG1 plasmablasts.Key words: B cells . Chemokines . Immunoglobulins . Knockout mice . Memory cells Supporting Information available online IntroductionSerum antibodies, in particular the isotypes other than IgM, bear the individual humoral immunological memory. They are produced by plasma cells, relatively long-lived cells, which integrate the recent immunological history into a longer-lasting, protective shield [1,2]. Unfortunately, in predisposed individuals, they also perpetuate the production of unwanted, harmful antibodies, like IgE in allergy and autoantibodies in autoimmune diseases [3]. The plasma cell, the final cell type in a long B-cell differentiation process, can be identified based on the expression of specific markers. Several markers that are specific for the B-cell lineage are down-regulated upon plasma cell differentiation, including major histocompatibility complex class II, CD19, CD21, CD22 and CD45 [4]. In contrast, the proteoglycan syndecan-1 (syn-1 or CD138) is up-regulated and serves as an identifying surface marker for plasma cells. Although some plasma cells persist in the spleen, most of them return to their ''place of birth'' and home to the bone marrow or inflamed tissues where they persist for up to several months in survival niches as resident, immobile cells [5,6]. Longevity of the plasma cell is influenced by a broad panel of stimuli, including cytokines like IL-5, IL-6, TNF-a, GM-CSF and, also, the chemokine CXCL12 [7,8].It is believed that the contact with stroma cells in the bone marrow provides further adhesion-dependent signals supporting plasma cell longevity [9]. The lifespan of plasma cells is limited by the immigration of newly formed migratory plasmablasts that compete with old plasma cells for space in the survival niches [3]. The migration of plasmablasts to the bone marrow is a critical differentiation step to long-lived plasma cells. Chemokines and their receptors are cruc...

show abstract

Section: Methodsmentioning

confidence: 99%

“…Spleen cells for in vitro induction were activated with LPS and IL-4 as described elsewhere [32]. The ELISA assay for IgE quantification was performed as described before [15, 26, 31].…”

Section: Methodsmentioning

confidence: 99%

Migration of antibody secreting cells towards CXCL12 depends on the isotype that forms the BCR

et al. 2008

Self Cite

View full text Add to dashboard Cite

show abstract

“…The existence of surface IgE positive (memory) B cells in WT mice has only been demonstrated indirectly and has only recently been analyzed by IgE‐GFP tagged mice . Even IgE transgenic mice do not display detectable numbers of surface IgE expressing cells in vivo .…”

Section: Resultsmentioning

confidence: 99%

IgE knock‐in mice suggest a role for high levels of IgE in basophil‐mediated active systemic anaphylaxis

et al. 2013

View full text Add to dashboard Cite

Immunglobulin E (IgE) production is tightly regulated at the cellular and genetic levels and is believed to be central to allergy development. At least two cellular pathways exist that lead to systemic anaphylaxis reactions in vivo: IgE-sensitized mast cells and IgG1-sensitized basophils. Passive anaphylaxis, by application of allergen and allergen-specific antibodies in mice, indicates a differential contribution of immunoglobulin isotypes to anaphylaxis. However, analysis of a dynamic immunization-mediated antibody response in anaphylaxis is difficult. Here, we generated IgE knock-in mice (IgE ki ), which express the IgE heavy chain instead of IgG1, in order to analyze the contribution of IgG1 and IgE to active anaphylaxis in vivo. IgE ki mice display increased IgE production both in vitro and in vivo. The sensitization of IgE ki mice by immunization followed by antigen challenge leads to increased anaphylaxis. Homozygous IgE ki mice, which lack IgG1 due to the knock-in strategy, are most susceptible to active systemic anaphylaxis. The depletion of basophils demonstrates their importance in IgE-mediated anaphylaxis. Therefore, we propose that an enhanced, antigen-specific, polyclonal IgE response, as is the case in allergic patients, is probably the most efficient way to sensitize basophils to contribute to systemic anaphylaxis in vivo.Keywords: Active systemic anaphylaxis r Allergy model r Basophils r IgE knock-in Additional supporting information may be found in the online version of this article at the publisher's web-site IntroductionAllergy has become a major threat to public health in developed countries [1,2]. In particular, systemic anaphylaxis, whichCorrespondence: Dr. Philipp Yu e-mail: Philipp.Yu@staff.uni-marburg.de is a rapid and often fatal allergic reaction to a systemic allergen exposure, e.g. a bee sting into the vascular system, necessitates a fundamental understanding of the immune parameters involved. The causative association of allergen-specific Immunglobulin E (IgE), the high-affinity IgE receptor (FcεRI), and mast cells for immediate type allergy and anaphylaxis has been studied for Eur. J. Immunol. 2013Immunol. . 43: 1231Immunol. -1242 decades [3][4][5]. However, since the discovery of anaphylaxis in IgE-deficient mice [6] and more recently studies on basophil biology, a number of publications have focused on the contribution of alternative pathways to anaphylaxis [7][8][9]. It has become evident that the isotype, quantity, and quality of the sensitizing antibodies are important parameters for anaphylaxis [9]. In summary, at least two mutually nonexclusive pathways exist that employ allergen-mediated cross-linking of either receptor bound IgE and/or receptor bound IgG and lead to activation of mast cells and/or basophils leading to release of inflammatory substances, e.g. histamine or platelet activating factor [7,10].Nevertheless, experiments to examine the role of the active polyclonal antibody response in anaphylaxis are hampered by the low expression of IgE and a low frequency of...

show abstract

Construction of an sIgE:FLAG-mIgE:GFP Reporter Mouse Strain

Cited by 2 publications

References 22 publications

Migration of antibody secreting cells towards CXCL12 depends on the isotype that forms the BCR

Migration of antibody secreting cells towards CXCL12 depends on the isotype that forms the BCR

IgE knock‐in mice suggest a role for high levels of IgE in basophil‐mediated active systemic anaphylaxis

Contact Info

Product

Resources

About