Comprehensive genetic analysis identifies a pathognomonic NAB2/STAT6 fusion gene, nonrandom secondary genomic imbalances, and a characteristic gene expression profile in solitary fibrous tumor

Abstract

Solitary fibrous tumor (SFT) is a mesenchymal neoplasm displaying variable morphologic and clinical features. To identify pathogenetically important genetic rearrangements, 44 SFTs were analyzed using a variety of techniques. Chromosome banding and fluorescence in situ hybridization (FISH) showed recurrent breakpoints in 12q13, clustering near the NAB2 and STAT6 genes, and single nucleotide polymorphism array analysis disclosed frequent deletions affecting STAT6. Quantitative real-time PCR revealed high expression levels of the 5'-end of NAB2 and the 3'-end of STAT6, which at deep sequencing of enriched DNA corresponded to NAB2/STAT6 fusions. Subsequent reverse-transcriptase PCR (RT-PCR) analysis identified a NAB2/STAT6 fusion in 37/41 cases, confirming that this fusion gene underlies the pathogenesis of SFT. The hypothesis that the NAB2/STAT6 fusions will result in altered properties of the transcriptional co-repressor NAB2--a key regulator of the early growth response 1 (EGR1) transcription factor - was corroborated by global gene expression analysis; SFTs showed deregulated expression of EGR1 target genes, as well as of other, developmentally important genes. We also identified several nonrandom secondary changes, notably loss of material from 13q and 14q. As neither chromosome banding nor FISH analysis identify more than a minor fraction of the fusion-positive cases, and because multiple primer combinations are required to identify all possible fusion transcripts by RT-PCR, alternative diagnostic markers might instead be found among deregulated genes identified at global gene expression analysis. Indeed, using immunohistochemistry on tissue microarrays, the top up-regulated gene, GRIA2, was found to be differentially expressed also at the protein level.

Solitary fibrous tumors: loss of chimeric protein expression and genomic instability mark dedifferentiation

“…Furthermore uncommon variants with intronic and/or intraexonic breakpoints have been described. [5][6][7] NAB2/STAT6 fusion transcripts were detected in all of the tested tumor samples, and corresponded to nine different fusion types: four fusions have been previously described (see Table 1); the remaining five involved intronic sequences and/or exonic fusion/breakpoints while retaining the reading frame (Table 1 and Supplementary Figure S1). There was no correlation between the fusion type and tumor malignancy/dedifferentiation or site, but there was a significant association between a younger age at the time of onset and fusions with STAT6 (MannWhitney, two-tailed, n 1 = 13, n 2 = 8, P o 0.05) or NAB2 distal breakpoints (Mann-Whitney, twotailed, n 1 = 16, n 2 = 5, P o 0.05).…”

“…1-6) as having usual, 8 as having malignant (nos. [7][8][9][10][11][12][13][14], and 10 as having dedifferentiated solitary fibrous tumors (nos. [15][16][17][18][19][20][21][22][23][24].…”

“…14 The primers used to detect NAB2/STAT6 fusion products were the previously described NAB2ex5F (CCTGTCTGGGGAGAGTCTGGATG)/STAT6ex20R(GG GGGGATGGAGTGAGAGTGTG) 6 and NAB2ex21051F (GCCCGAGAGCACCTACTT)/STAT6ex4762R(AGGTG GATCTCCCCTACTTCG); 7 the polymerase chain reaction conditions have been described elsewhere. 7 After treatment with ExoSap IT (Affymetrix, Santa Clara, CA, USA), the amplified products were directly sequenced using a Big Dye v1.1 cycle sequencing kit and a 3500Dx genetic analyzer (Thermo Fisher Scientific, Waltham, MA, USA).…”

“…However, in 2013, whole exome and trancriptome sequencing-based studies 5,6 revealed a chromosomal rearrangement leading to a NAB2/ STAT6 gene fusion that has now been recognized as the hallmark of solitary fibrous tumors on the basis of gene-specific reverse-transcription polymerase chain reaction analyses of solitary fibrous tumor series including usual and malignant variants. [5][6][7][8] NAB2 and STAT6 are contiguous and partially overlapping genes with opposite transcription orientations on chromosome 12q13.3. NAB2 is a nuclear protein that acts as a repressor of the transcription induced by some members of the early growth response (EGR) family of transactivators (particularly EGR1) and mediated by interactions with the nucleosome remodeling and deacetylase complex.…”

“…The fusion types NAB2 exon 6/STAT6 exon 17 and NAB2 exon 6/STAT6 exon 18 have recently been associated with malignant behavior, an extrapleural location and a younger age at onset, 8 although this association has not been observed in other studies. 6,7 The discovery of the NAB2/STAT6 fusion made it possible to diagnose solitary fibrous tumor molecularly using reverse-transcription polymerase chain reaction; moreover, the overexpression and phosphorylation-independent nuclear translocation of the STAT6 C-terminus can be readily identified by means of STAT6 immunohistochemistry, a sensitive, specific and more widely available means of accurate diagnosis. 6,10,11 However, although the presence of the NAB2/STAT6 rearrangement is pathognomonic for solitary fibrous tumors, it does not provide any known insights into the biological basis of the spectrum, prognosis or progression of the tumors.…”