Complete genomic structure of mouse lysyl hydroxylase 2 and lysyl hydroxylase 3/collagen glucosyltransferase

Glycosylation catalyzed by lysyl hydroxylase 3 is essential for basement membranes

“…In the LH3 knockout (Table 1) the Plod3 gene was disrupted by an insertion of an IRES-␤-gal-polyANeo cassette into exon 2 leading to the absence of LH3. In the hypomorphic mouse line, the Neo cassette was inserted into intron 18 and also the LH activity of the multifunctional LH3 was disrupted by a point mutation, Asp669Ala (Heikkinen et al, 2000), in exon 18 (Ruotsalainen et al, 2001). The LH activity of the point-mutated human (Heikkinen et al, 2000) Journal of Cell Science 119 (4) and mouse recombinant protein was undetectable in vitro, whereas the GGT and GT activities were unchanged.…”

“…Genomic clones carrying the Plod3 gene were isolated from a mouse BAC library (Ruotsalainen et al, 2001). Two different constructs were generated to manipulate the LH3 activities in vivo (Fig.…”

The lysyl hydroxylase isoforms are widely expressed during mouse embryogenesis, but obtain tissue- and cell-specific patterns in the adult

“…Lysyl hydroxylase activity in human, mouse and rat tissues is present in three different molecules, LH1, LH2 and LH3, originating from three different genes (Armstrong and Last, 1995;Hautala et al, 1992;Mercer et al, 2003;Passoja et al, Matrix Biology 25 (2006) 475 -483 www.elsevier.com/locate/matbio 1998; Ruotsalainen et al, 1999Ruotsalainen et al, , 2001Valtavaara et al, 1997Valtavaara et al, , 1998. Our phylogenetic data suggest that LH1 and LH2 are more closely related and produced by a more recent duplication than the less closely related LH3 (Ruotsalainen et al, 1999).…”

“…Oligonucleotides corresponding to the nucleotide sequences of exon 9 (HIIR45, CTGGACAAGGCTGCTCGACTA) and exon 14 (HIIR46, CCTGAACTTACTGTTAACACTGG) of the mouse LH2 gene (Ruotsalainen et al, 2001) were used to amplify exon 13A. PCR products were analyzed using a 1% agarose gel.…”

Overexpression of Lysyl Hydroxylase-2b Leads to Defective Collagen Fibrillogenesis and Matrix Mineralization

“…(2) The difference in the extent of Lys hydroxylation of collagen depends on genetic types, tissues, tissue's physiological conditions, and domains (helical versus nonhelical telopeptides) of a collagen molecule. (1) Recently, three genes encoding for isoforms of LH (procollagen-lysine, 2-oxoglutarate, 5-dioxygenase; PLOD 1-3) have been cloned and characterized in mice, (3,4) humans, (5)(6)(7)(8) and rats. (9) In addition, an alternative splice form of LH2, LH2b or LH2alt, with an additional 63-bp exon 13A, has been identified.…”