Complete Genome Sequence of the Porcine Epidemic Diarrhea Virus Strain SLO/JH-11/2015

Toplak, Ivan; Ipavec, Manica; Kuhar, Urška; Kušar, Darja; Papić, Bojan; Koren, Simon; Toplak, Nataša

doi:10.1128/genomea.01725-15

Cited by 14 publications

(20 citation statements)

References 11 publications

(13 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In France, an outbreak caused by an S INDEL strain was reported in 2015 by Grasland and Bigault. Similar cases affecting mostly fattening pigs with mild diarrhoea were reported from Belgium (Theuns et al, 2015), Germany (Stadler et al, 2015), Austria (Steinrigl et al, 2015), Portugal (Mesquita et al, 2015), Slovenia (Toplak et al, 2016) and Italy (Bertasio et al, 2016), while in Ukraine a highly pathogenic virus caused an outbreak with nearly 100% mortality rate among piglets under 10 days of age (Dastjerdi et al, 2015). In Hungary, the first PED outbreak was reported in 1977 by Benyeda et al, and the last PEDV-positive pigs were found in 2009, although there is no report describing that case (EFSA AHAW Panel, 2014).…”

supporting

confidence: 77%

Porcine epidemic diarrhoea virus with a recombinant S gene detected in Hungary, 2016

Valkó

Biksi

Cságola

et al. 2017

Acta Veterinaria Hungarica

View full text Add to dashboard Cite

Porcine epidemic diarrhoea virus (PEDV) can cause a severe enteric disease affecting pigs of all ages. In January 2016, diarrhoea with occasional vomiting was observed in a small pig farm in Hungary. All animals became affected, while mortality (of up to 30%) was only seen in piglets. Samples from different age groups and the carcass of a piglet were examined by various methods including pathology, bacteriology and molecular biology. PEDV was confirmed by PCR and its whole genome sequence was determined. The sequence PEDV HUN/5031/2016 showed high identity with recently reported European viruses. Differences were found mostly in the S gene, where recombination was detected with a newly identified and already recombinant swine enteric coronavirus (SeCoV) from Italy. The present report describes the first porcine epidemic diarrhoea outbreak in Hungary after many years and gives an insight into the genetics of the Hungarian PEDV.

show abstract

supporting

confidence: 77%

Porcine epidemic diarrhoea virus with a recombinant S gene detected in Hungary, 2016

Valkó

Biksi

Cságola

et al. 2017

Acta Veterinaria Hungarica

View full text Add to dashboard Cite

show abstract

“…The full genome sequencing of recent PEDV strains from Germany, Belgium and France [17][18][19] shows that they are all highly similar and closely related to S-INDEL strains from USA [9,13]. Also, the virus recovered from PED outbreaks in Austria and Slovenia [15,22] is almost identical to other currently circulating PEDV from Western and Central Europe, which suggests a common source of introduction [17]. This may suggest that INDEL strains circulate in Europe for a longer time than was previously hypothesized [9,18].…”

Section: Introductionmentioning

confidence: 78%

“…For amplifi cation, the commercial OneStep RT-PCR kit (Qiagen, Germany) was used with primers that amplifi ed the 651 bp fragment of spike protein (S) gene of PEDV (P1 (TTCTGAGTCACGAACAGCCA, 1466-1485) and P2 (CATATGCAGCCTGCTCTGAA, 2097-2116)), 859 bp fragment of S gene of TGEV (T1 (GTGGTTTTGGTYRTAAATGC, [16][17][18][19][20][21][22][23][24][25][26][27][28][29][30][31][32][33][34][35] and T2 (CACTAACCAACGTGGARCTA, 855-874)), and 309 bp fragment of gene segment 6 of porcine group A rotavirus (rot3 (AAAGATGCTAGGGACAAAATTG, 57-78) and rot5 (TTCAGATTGTGGAGCTATTCCA, 344-365)) as described by Song et al [23]. Briefl y, the reaction was performed in a total volume of 25 μl as follows: 8 μl of nuclease free water, 5 μl of 5 x PCR buffer, 1 μl of dNTP mix (containing 10 mM of each dNTP), 1 μl of 20 μM solution of each primer, 1 μl of one step RT-PCR enzyme mix and 4 μl of RNA template.…”

Section: Molecular Detection and Characterizationmentioning

confidence: 99%

“…The only well documented is a typical PED epidemic in Europe which occurred during the winter of 2005-2006 in Northern Italy [16]. Recently, the PED-confi rmed outbreaks have been reported in several Central European countries: Portugal [7], Germany [15], Austria [17], France [18], Belgium [19], Ukraine [20], Italy [21] and Slovenia [22]. The full genome sequencing of recent PEDV strains from Germany, Belgium and France [17][18][19] shows that they are all highly similar and closely related to S-INDEL strains from USA [9,13].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

First Detection and Clinical Presentation of Porcine Epidemic Diarrhea Virus (Pedv) in Serbia

et al. 2017

View full text Add to dashboard Cite

During 2015/2016, fecal and intestinal samples from live diseased and/or dead pigs with suspected PEDV and/or TGEV and signs of rotavirus infection were collected from in total seven different farrow-to-finish swine farms located in Northern Serbia region (Vojvodina Province). A total of 14 samples (2 pools per farm) of small intestine with fecal content were submitted to laboratory molecular investigation (multiplex RTPCR). On these farms the clinical signs included the occurrence of diarrhea in suckling and weaned piglets, with weak or no response to the applied antimicrobial therapy. The epidemic of severe diarrhea affecting pigs of all ages on one farrow-to finish swine farm was detected in January 2016. Watery diarrhea in all swine categories was associated with vomiting and a reduction in feed consumption. Diarrheic, gaunt and dehydrated piglets, covered with feces were found in 90% litters. The disease affected most severely the suckling piglets, and the mortality in newborn piglets was up to 35%. In the weaned piglets and fatteners the mortality was up to 2.5% and 1.2%, respectively. The PEDV RNA was detected in pooled feces and samples of small intestines derived from diseased and dead suckling piglets from only one investigated farm. The PEDV positive samples showed to be negative for rotavirus group A and TGEV. The transport vehicles were identified as the main possible route of PEDV introduction. This is the first report demonstrating the presence of PEDV in Serbia.

show abstract

“…The recent reappearance of PEDV (closely related to the INDEL OH 851 strain) infections within Europe, including in Germany, France, Italy, Portugal, The Netherlands and Slovenia (Hanke et al, 2015;Grasland et al, 2015;Boniotti et al, 2016;Mesquita et al, 2015;Toplak et al, 2016;EFSA, 2014), has led to the need for an assessment of existing diagnostic assays for the detection of PEDV infections. The PEDV can be identified by RT-PCR (e.g.…”

Section: Introductionmentioning

confidence: 99%

Inter-laboratory study to characterize the detection of serum antibodies against porcine epidemic diarrhoea virus

Strandbygaard

Llombart‐Bosch

Lelli

et al. 2016

Veterinary Microbiology

View full text Add to dashboard Cite

Porcine epidemic diarrhea virus (PEDV) has caused extensive economic losses to pig producers in many countries. It was recently introduced, for the first time, into North America and outbreaks have occurred again in multiple countries within Europe as well. To assess the properties of various diagnostic assays for the detection of PEDV infection, multiple panels of porcine sera have been shared and tested for the presence of antibodies against PEDV in an inter-laboratory ring trial. Different laboratories have used a variety of “in house” ELISAs and also one commercial assay. The sensitivity and specificity of each assay has been estimated using a Bayesian analysis applied to the ring trial results obtained with the different assays in the absence of a gold standard. Although different characteristics were found, it can be concluded that each of the assays used can detect infection of pigs at a herd level by either the early European strains of PEDV or the recently circulating strains (INDEL and non-INDEL). However, not all the assays seem suitable for demonstrating freedom from disease in a country. The results from individual animals, especially when the infection has occurred within an experimental situation, show more variation

show abstract

Complete Genome Sequence of the Porcine Epidemic Diarrhea Virus Strain SLO/JH-11/2015

Cited by 14 publications

References 11 publications

Porcine epidemic diarrhoea virus with a recombinant S gene detected in Hungary, 2016

Porcine epidemic diarrhoea virus with a recombinant S gene detected in Hungary, 2016

First Detection and Clinical Presentation of Porcine Epidemic Diarrhea Virus (Pedv) in Serbia

Inter-laboratory study to characterize the detection of serum antibodies against porcine epidemic diarrhoea virus

Contact Info

Product

Resources

About