Comparison of the detection efficiency of haemoparasite DNA in blood and faecal samples – the way to eco-epidemiological studies

Abstract

Introduction and objective. It is easier and non-invasive to obtain faecal samples compared with blood samples. Molecular techniques may enable detection of parasites even in tiny amounts of blood-containing faeces. We aimed to compare the sensitivity of detection of three Babesia species and Hepatozoon canis in blood and faecal samples, including samples derived from naturally infected hosts. Materials and method. Three groups were involved: 1) Nine BALB/c mice infected with Babesia microti sampled during acute (n=3), post-acute (n=3) and chronic phases of infection (n=3); 2) Eight dogs with symptoms of babesiosis; 3) Six red foxes infected with B. vulpes, one fox infected with B. canis, four foxes infected with H. canis. Genomic DNA was extracted from blood and faeces by use of commercial kits and amplified with genus-specific primers in one-step or nested PCR reactions. Selected PCR products were sequenced. Results. No positive results for faecal samples were obtained from H. canis-positive foxes in contrast to Babesia spp. infections. Positive results from PCRs were obtained for all BALB/c mice (100%), five dogs (62.5%) and four of seven foxes (57.1%). Successful sequencing was obtained for six selected murine samples (B. microti), four canine samples (B. canis) and for one fox sample (B. vulpes). The success of B. microti detection in murine faecal samples from acute, post-acute and chronic phases was identical (100%). Conclusions. Detectability of Babesia spp. infections was lower in naturally infected dogs and foxes, compared to experimentally infected mice. Detection of DNA in faecal samples can be useful in the detection of Babesia infection in populations from which blood samples are hard to obtain, but due regard must be given to the possibility that prevalence of infection may be severely underestimated.

Occurrence of Babesia Species and Co-Infection with Hepatozoon canis in Symptomatic Dogs and in Their Ticks in Eastern Romania

“…The extracted DNA was stored at −20 °C. Specific primers were used to amplify the 18S rRNA gene fragment of Babesia/Theileria (559 bp): BabGF:5′-GYYTTGTAATTGGAATGATGG-3′; BabGR: 5′- CCAAAGACTTTGATTTCTCTC-3′ [ 79 ]; and H. canis (666bp): HepF:5′ ATACATGAGCAAAATCTCAAC -3′; Hep R: 5′-CTTATTATTCCATGCTGCAG -3′ [ 80 ].…”

“…Reactions were performed using the PCR protocol described by Bajer et al [ 79 ] with some modifications for Babesia spp. Detection: a single end-point PCR was performed preparing a total 25 μL PCR volume (22 μL of PCR mix + 3 μL of the extracted DNA sample) for each sample with 1x buffer (EcoTaq PLUS, Lucigen, WI, USA) and 0.5 μM of each primer [ 79 ]. For H. canis, PCR was performed according to Inokuma et al [ 80 ].…”

The first report on Hepatozoon canis in dogs and wolves in Poland: clinical and epidemiological features

“…Our results support those reported previously, proving that monitoring for blood protozoan parasites ( Babesia sp., Hepatozoon sp.) can be based on screening not only blood samples but also noninvasively obtained faecal samples [ 56 , 57 ].…”

Co-Infection With Babesia Canis and Borrelia Burgdorferi S.L. In a Dog From Northeastern Romania: A Case Report

“…The PCR test for the identification of Babesia spp. was performed according to the protocol described by Bajer et al (2019). Briefly, the primers used were BabGF and BabGR primers to amplify the 18S rRNA gene fragment of Babesia/Theileria (559 bp), with the following thermal profile: 94°C for 3 minutes, followed by 45 cycles at 94°C for 30 seconds, 59°C for 30 seconds, 72°C for 60 seconds, with a final extension at 72°C for 7 minutes.…”