Cloning, expression and characterization of SeM protein of Streptococcus equi subsp. equi and evaluation of its use as antigen in an indirect ELISA

Toxocariasis is a zoonotic disease that affects humans and animals alike. Although recombinant proteins are widely used for its diagnosis in humans, their performance in companion and production animals remains unknown. This study aimed to investigate the serodiagnostic potential of the recombinant proteins rTES–30 and rTES–120 from Toxocara canis in an indirect ELISA for cattle, horses, and sheep. Serum samples collected from the animals were tested with indirect ELISA and Western Blotting using T. canis TES–30 and TES–120 recombinant proteins produced in Escherichia coli, as well as native-TES. In the ELISA, rTES–30 showed high serodiagnostic potential in sheep and horses (92.6% and 85.2%, respectively), while the sensitivity of rTES–120 was higher in cattle and horses (97.2% and 92.6%, respectively). Furthermore, a highly positive association was observed between native and recombinant proteins in seropositive samples, while a moderately positive association was observed in seronegative samples, probably due to the lower specificity of native TES. In conclusion, our study indicates that the use of recombinant proteins in an indirect ELISA is an effective tool for the serodiagnosis of toxocariasis in animals, with the choice of protein being species-dependent.

show abstract

“…Sera panel-3 consisted out of samples from 38 non-immunized horses used for the study by Moraes et al . (2014) [ 22 ].…”

Section: Methodsmentioning

confidence: 99%

“…This retrospective study was previously approved by the Federal University of Pelotas Ethical Research Committee under protocol CEEA 2133 [ 5 , 21 , 22 ].…”

Section: Methodsmentioning

confidence: 99%

The serodiagnostic potential of recombinant proteins TES–30 and TES–120 in an indirect ELISA in the diagnosis of toxocariasis in cattle, horses, and sheep

et al. 2019

View full text Add to dashboard Cite

show abstract

“…The recombinant protein was produced as previously described (Moraes et al 2014, Maciel et al 2017. Briefly, the SeM sequence (access number U73162) was amplified using specific primers (Primer forward: 5'CGGGATCCTCGAGGTTAGTCGTAC3'; primer reverse: 5'GGGGTACCTTAGTTTTCTTTGCGT3') and cloned into the pAE vector (Ramos et al 2004).…”

Section: Methodsmentioning

confidence: 99%

Immunogenicity of Streptococcus equi subsp. equi recombinant SeM protein and bacterin in mice

2021

View full text Add to dashboard Cite

The infection caused by Streptococcus equi, known as strangles, affects the respiratory system of horses, causing high morbidity and rapid spread among the herd. Bacterin vaccines, composed of inactivated whole cells of S. equi, have variable efficacy and duration. Infected animals produce specific antibodies against SeM, the immunodominant antigen of S. equi. This makes it a promising target for vaccine development. In this context, the objective of this work was to evaluate a vaccine combining S. equi bacterin and recombinant SeM protein. Mice were vaccinated with bacterin (S. equi ~1.2 × 108CFU/ml); rSeM protein (20μg); bacterin-rSeM combination; or PBS (Control Group) and challenged with a suspension of S. equi, containing 10 × LD50. All vaccinated mice survived the challenge and produced anti-rSeM and anti-S. equi antibodies, which were assessed by indirect ELISA. The Control Group reached endpoint criteria 96 h after infection. These results demonstrate that a vaccine combining the S. equi bacterin with rSeM protein protects mice against strangles. This combination vaccine could potentially protect horses and overcome the limitations of currently available strangle vaccines.

show abstract

“…Strangles is characterized by lymphoid abscesses near the lymph nodes in the horse's head and neck [70]. This disease is associated with high morbidity and low mortality [71].…”

Section: Streptococcus Equi Subsp Equimentioning

confidence: 99%

“…Strangles is characterized by lymphoid abscesses near the lymph nodes in the horse’s head and neck [70]. This disease is associated with high morbidity and low mortality [71]. Complications of the disease may include haemorrhagic purpura, myositis and bronchopneumonia [72].…”

Section: Introductionmentioning

confidence: 99%

Pathogenicity and drug resistance of animal streptococci responsible for human infections

Glajzner

Szewczyk

Szemraj

2021

Journal of Medical Microbiology

View full text Add to dashboard Cite

Bacteria of the genus Streptococcus , earlier considered typically animal, currently have also been causing infections in humans. It is necessary to make clinicians aware of the emergence of new species that may cause the development of human diseases. There is an increasing frequency of isolation of streptococci such as S. suis , S. dysgalactiae , S. iniae and S. equi from people. Isolation of Streptococcus bovis/Streptococcus equinus complex bacteria has also been reported. The streptococcal species described in this review are gaining new properties and virulence factors by which they can thrive in new environments. It shows the potential of these bacteria to changes in the genome and the settlement of new hosts. Information is presented on clinical cases that concern streptococcus species belonging to the groups Bovis, Pyogenic and Suis. We also present the antibiotic resistance profiles of these bacteria. The emerging resistance to β-lactams has been reported. In this review, the classification, clinical characteristics and antibiotic resistance of groups and species of streptococci considered as animal pathogens are summarized.

show abstract

Cloning, expression and characterization of SeM protein of Streptococcus equi subsp. equi and evaluation of its use as antigen in an indirect ELISA

Cited by 4 publications

References 23 publications

The serodiagnostic potential of recombinant proteins TES–30 and TES–120 in an indirect ELISA in the diagnosis of toxocariasis in cattle, horses, and sheep

The serodiagnostic potential of recombinant proteins TES–30 and TES–120 in an indirect ELISA in the diagnosis of toxocariasis in cattle, horses, and sheep

Immunogenicity of Streptococcus equi subsp. equi recombinant SeM protein and bacterin in mice

Pathogenicity and drug resistance of animal streptococci responsible for human infections

Contact Info

Product

Resources

About