Chromosomal assignment of the human thrombin receptor gene: localization to region q13 of chromosome 5

Abstract

A functional thrombin receptor (TR) structurally related to other members of the seven-transmembrane receptor family has been isolated from diverse cellular types intimately involved in the regulation of the thrombotic response. This receptor recapitulates many of the previously identified sequelae of thrombin-mediated cell activation phenomenon, and requires proteolytic cleavage for downstream effector- response coupling events. Using two complementary approaches, we have now completed the chromosomal assignment of the human thrombin receptor gene. Discordancy analysis of polymerase chain reaction products from a human-rodent hybrid cell mapping panel assigned the sequence to human chromosome 5 with no observed discordancies. Cytogenetic localization using fluorescence in situ hybridization on human metaphase chromosomes specifically localized the human TR gene to region q13 of chromosome 5, confirming its presence as a single-locus gene in the human genome. The chromosomal localization of the human TR gene is at or contiguous with the proximal breakpoint site identified in the majority of patients with the 5q- syndrome (dysmegakaryocytopoiesis and refractory anemia).

The human thrombin receptor and proteinase activated receptor‐2 genes are tightly linked on chromosome 5q13

“…Southern blot analysis demonstrated thrombin receptorspecific or PAR-2-specific fragments using total human genomic or HHW105 DNA (Fig 1). The hybridization patterns in the identical cell lines established that both genes are present in the same region of the human genome, 5q11.2 → 5q13.3, which is consistent with gene localization using FISH analysis (Bahou et al, 1993b;Nystedt et al, 1995).…”

“…A detailed description of these panels is beyond the scope of this report, although a schema outlining their applicability in genetic mapping is outlined below. PCR screening was completed using the following oligonucleotide primers: PAR-2: PAR1814 (5 0 -3 0 : CAACATG-TACTGTTCCAT, bp 471-488) and PAR1846 (5 0 -3 0 : CACAT-GATTTCAGGGATCATGCAA, bp 1066-1043); D5S424 (Dib et al, 1996): D1: (5 0 -3 0 : GGGTACATGGGAGTTCATTGG; D2 (5 0 -3 0 : TCTCATGCTGGCAGGGATA); the thrombin receptor specific primers were as previously described (Bahou et al, 1993b). PCR conditions were optimized for each primer pair, but generally included a 1 .…”

“…Genomic analysis and inversion field gel electrophoresis. DNA from normal human volunteers was extracted from peripheral blood leucocytes as previously described (Bahou et al, 1993b) and quantitated by absorption spectrophotometry at 260 nm. Yeast artificial chromosomes containing distinct portions of human chromosome DNA (YACs) were purchased from Research Genetics (Huntsville, Ala.), and DNA was isolated using standard methods.…”

“…9 V/cm in 0 . 5 × TBE buffer at 10ЊC with a pulse timer of 1-50 s and a forward/reverse (F/R) ratio of 3 : 1 for 24 h. Gels were blotted onto nylon membranes (Schleicher and Schuell, Keene, N.H.) and hybridized to either the 32 P-radiolabelled thrombin receptor cDNA (Bahou et al, 1993b) or PAR-2 cDNA (Mirza et al, 1996) as probe. Blots were washed to high stringency (0 .…”

Effect of a thrombin receptor (protease‐activated receptor 1, PAR‐1) gene polymorphism in chronic hepatitis C liver fibrosis

“…21 The PAR-1 gene is located in the short arm of chromosome 5 and comprises 2 exons separated by a large intron. 22,23 Two polymorphisms have been identified in the 5′ regulatory region: a C > T transition 1426 base pair upstream of the transcription start site (-1426 C/T) and a 13-bp repeat of the preceding -506 5′-CGGCCGCGGGAAG-3′ sequence (-506 I/D, where I represents insertion and D deletion). The third polymorphism is an A > T transversion in the intervening sequence (IVS) that is 14 nucleotides upstream from the exon start site (IVS-14A/T).…”