Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Chan, E. C. S.; Klitorinos, A.; Gharbia, SE; Caudry, S. D.; Rahal, M. D.; Siboo, R.

doi:10.1111/j.1399-302x.1996.tb00196.x

Cited by 21 publications

(15 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Several of them revealed to be invasive in vivo and in vitro [94,95]. Six different periodontal pathogen spirochetes, specifically, T. denticola , T. pectinovorum, T. vincenti, T. amylovorum, T. maltophilum, T. medium and T. socranskii were detected in the brains of AD patients using species specific PCR.…”

Section: Association Of Spirochetes and Alzheimer's Diseasementioning

confidence: 99%

Alzheimer's disease - a neurospirochetosis. Analysis of the evidence following Koch's and Hill's criteria

Miklóssy

2011

J Neuroinflammation

309

284

View full text Add to dashboard Cite

It is established that chronic spirochetal infection can cause slowly progressive dementia, brain atrophy and amyloid deposition in late neurosyphilis. Recently it has been suggested that various types of spirochetes, in an analogous way to Treponema pallidum, could cause dementia and may be involved in the pathogenesis of Alzheimer's disease (AD). Here, we review all data available in the literature on the detection of spirochetes in AD and critically analyze the association and causal relationship between spirochetes and AD following established criteria of Koch and Hill. The results show a statistically significant association between spirochetes and AD (P = 1.5 × 10-17, OR = 20, 95% CI = 8-60, N = 247). When neutral techniques recognizing all types of spirochetes were used, or the highly prevalent periodontal pathogen Treponemas were analyzed, spirochetes were observed in the brain in more than 90% of AD cases. Borrelia burgdorferi was detected in the brain in 25.3% of AD cases analyzed and was 13 times more frequent in AD compared to controls. Periodontal pathogen Treponemas (T. pectinovorum, T. amylovorum, T. lecithinolyticum, T. maltophilum, T. medium, T. socranskii) and Borrelia burgdorferi were detected using species specific PCR and antibodies. Importantly, co-infection with several spirochetes occurs in AD. The pathological and biological hallmarks of AD were reproduced in vitro by exposure of mammalian cells to spirochetes. The analysis of reviewed data following Koch's and Hill's postulates shows a probable causal relationship between neurospirochetosis and AD. Persisting inflammation and amyloid deposition initiated and sustained by chronic spirochetal infection form together with the various hypotheses suggested to play a role in the pathogenesis of AD a comprehensive entity. As suggested by Hill, once the probability of a causal relationship is established prompt action is needed. Support and attention should be given to this field of AD research. Spirochetal infection occurs years or decades before the manifestation of dementia. As adequate antibiotic and anti-inflammatory therapies are available, as in syphilis, one might prevent and eradicate dementia.

show abstract

Section: Association Of Spirochetes and Alzheimer's Diseasementioning

confidence: 99%

Alzheimer's disease - a neurospirochetosis. Analysis of the evidence following Koch's and Hill's criteria

Miklóssy

2011

J Neuroinflammation

309

284

View full text Add to dashboard Cite

show abstract

“…coli-T. denticola shuttle plasmids. Available shuttle plasmids for T. denticola are all based on pTS1, a cryptic plasmid from an oral Treponema clinical isolate (2,15). For these studies, we used pBFC (16), which encodes resistance to Km in E. coli and Cm in T. denticola (Fig.…”

Section: Methodsmentioning

confidence: 99%

A Modified Shuttle Plasmid Facilitates Expression of a Flavin Mononucleotide-Based Fluorescent Protein in Treponema denticola ATCC 35405

Godovikova

Goetting-Minesky

Shin

et al. 2015

Appl Environ Microbiol

View full text Add to dashboard Cite

Oral pathogens, including Treponema denticola, initiate the dysregulation of tissue homeostasis that characterizes periodontitis. However, progress of research on the roles of T. denticola in microbe-host interactions and signaling, microbial communities, microbial physiology, and molecular evolution has been hampered by limitations in genetic methodologies. This is typified by an extremely low transformation efficiency and inability to transform the most widely studied T. denticola strain with shuttle plasmids. Previous studies have suggested that robust restriction-modification (R-M) systems in T. denticola contributed to these problems. To facilitate further molecular genetic analysis of T. denticola behavior, we optimized existing protocols such that shuttle plasmid transformation efficiency was increased by >100-fold over prior reports. Here, we report routine transformation of T. denticola ATCC 35405 with shuttle plasmids, independently of both plasmid methylation status and activity of the type II restriction endonuclease encoded by TDE0911. To validate the utility of this methodological advance, we demonstrated expression and activity in T. denticola of a flavin mononucleotide-based fluorescent protein (FbFP) that is active under anoxic conditions. Addition of routine plasmid-based fluorescence labeling to the Treponema toolset will enable more-rigorous and -detailed studies of the behavior of this organism. In vitro studies of Treponema denticola and other oral spirochetes present unique challenges and opportunities in the field of molecular and cellular microbiology. As both commensal residents and pathogens of the subgingival oral mucosa, these nutritionally fastidious anaerobes are useful targets for research into microbehost interactions and signaling, microbial communities, microbial physiology, and molecular evolution. Furthermore, due to both physiological similarities between T. denticola and T. pallidum and the absence of a workable in vitro system to culture T. pallidum, T. denticola is of high interest as a model for the study of the microbial physiology and biosynthetic pathways of T. pallidum.Transformation of T. denticola ATCC 35405 by allelic replacement mutagenesis and by shuttle plasmids was first reported over 15 years ago (1, 2), but subsequent progress in this area continues to be hindered by extremely low transformation efficiency (1, 3). While T. denticola is somewhat tractable for simple gene knockouts, basic methods such as complementation analysis and expression of heterologous genes are problematic. The available shuttle plasmid system has at best an extremely limited ability to replicate in the most widely studied T. denticola strain (3-5). Thus, while plasmid-based methodologies are straightforward in the study of many prokaryotes, such studies present major obstacles to the rigorous molecular genetic analysis of treponemes.The T. denticola 35405 genome sequence reveals a robust DNA restriction-modification repertoire, including two complete type I restriction-modification lo...

show abstract

“…To prepare methylated pBFC, the plasmid was transformed into E. coli TOP10, which contains the dam gene encoding a DNA methyltransferase that methylates the N 6 position of the adenine residues in the sequence GATC (18,20). To prepare unmethylated CACTATCTAATATGAACAAAAATATAAAATATTCTC ermB cassette; F P 4 CCAGATTTTTTTTATTTCCTCCCGTTAAATAATAG ermB cassette; R P 5 GAGGAAATAAAAAAAATCTGGATTTGTGTATGT 3Ј-flanking region of TDE0911; F P 6 CACACGTAAAACAGATGAC 3Ј-flanking region of TDE0911; R P 7 CTAATCAACAAATAATACAGGTC TDE0911 probe; F P 8 CTATCTATGCTGTGCAAAATAG TDE0911probe; R P 9 CGAATGAAAAGGTACTCAACC ermB probe; F P 10 CCTCCCGTTAAATAATAG ermB probe; R P 11 CCAAATGATGCTTATGTTGC TDE0228 probe; F P 12 CCAAGTAAATTCTTGTTGCT TDE0228 probe; R P 13 CTCAGATAGTAAGGGTGT TDE1268 probe; F P 14 GGAGTTGTTGTCTTATCT TDE1268 probe; R P 15 GCACATGTAGGCTCAGCCCTGACCAAGTC aacC1 site mutagenesis; F P 16 GACTTGGTCAGGGCTGAGCCTACATGTGC aacC1site mutagenesis; R P 17 ATGTTACGCAGCAGCAACG aacC1 cassette; F P 18 TTAGGTGGCGGTACTTGGG aacC1cassette; R P 19 GAGCAACCAGAAATTGTTC 3Ј-flanking region of P 6 ; R a Underlined portions show the engineered overlapping base pairs. b Primer orientation: F, forward; R, reverse.…”

Section: Methodsmentioning

confidence: 99%

“…In addition, four plasmids have been isolated from several oral treponemes, including ATCC 33520, but none of these plasmids has been isolated from ATCC 35405 (4,5). Moreover, three shuttle vectors (pKMR4PE, pKMCou, and pBFC) that were derived from the plasmid pTS1 have been successfully transferred into ATCC 33520 but not ATCC 35405 (5,9,10,44). Thus far, there has been no shuttle vector available for the genetic complementation of mutants derived from T. denticola ATCC 35405.…”

mentioning

confidence: 99%

“…However, these two strains possess many physiological and genetic differences, such as serotype (7,8), oxygen tolerance (46), and biofilm formation capability (24,48,49). In addition, four plasmids have been isolated from several oral treponemes, including ATCC 33520, but none of these plasmids has been isolated from ATCC 35405 (4,5). Moreover, three shuttle vectors (pKMR4PE, pKMCou, and pBFC) that were derived from the plasmid pTS1 have been successfully transferred into ATCC 33520 but not ATCC 35405 (5,9,10,44).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Disruption of a Type II Endonuclease (TDE0911) Enables Treponema denticola ATCC 35405 To Accept an Unmethylated Shuttle Vector

Bian

2011

Appl Environ Microbiol

View full text Add to dashboard Cite

The oral spirochete Treponema denticola is associated with human periodontal disease. T. denticola ATCC 35405 and ATCC 33520 are two routinely used laboratory strains. Compared to T. denticola ATCC 33520, ATCC 35405 is more virulent but less accessible to genetic manipulations. For instance, the shuttle vectors of ATCC 33520 cannot be transformed into strain ATCC 35405. The lack of a shuttle vector has been a barrier to study the biology and virulence of T. denticola ATCC 35405. In this report, we hypothesize that T. denticola ATCC 35405 may have a unique DNA restriction-modification (R-M) system that prevents it from accepting the shuttle vectors of ATCC 33520 (e.g., the shuttle plasmid pBFC). To test this hypothesis, DNA restriction digestion, PCR, and Southern blot analyses were conducted to identify the differences between the R-M systems of these two strains. DNA restriction digestion analysis of these strains showed that only the cell extract from ATCC 35405 was able to digest pBFC. Consistently, PCR and Southern blot analyses revealed that the genome of T. denticola ATCC 35405 encodes three type II endonucleases that are absent in ATCC 33520. Among these three endonucleases, TDE0911 was predicted to cleave unmethylated double-stranded DNA and to be most likely responsible for the cleavage of unmethylated pBFC. In agreement with this prediction, the mutant of TDE0911 failed to cleave unmethylated pBFC plasmid, and it could accept the unmethylated shuttle vector. The study described here provides us with a new tool and strategy to genetically manipulate T. denticola, in particular ATCC 35405, and other strains that may carry similar endonucleases.More than 80% of the adult population at some time in their lives suffers from periodontal disease, which is primarily caused by polymicrobial infections (11, 37). More than 700 different microorganisms have been suggested to colonize the oral flora (13,27,36). A body of studies has shown that the presence and burden of oral spirochetes is associated with the severity of periodontal disease (16,36,42). In the oral flora, more than 60 different spirochete species have been identified, and they all belong to the genus Treponema (13, 36). Due to their fastidious growth requirements, very few oral treponemes can be reliably cultivated (6, 16). Treponema denticola, an oral spirochete that can be readily cultured, has been used as a model bacterium to study the biology and virulence of oral treponemes because its genome has been sequenced and it can be genetically manipulated (16,23,25,28,43,50).T. denticola ATCC 35405 and ATCC 33520 are two genetically related reference strains that are often used to study the genetics and virulence of spirochetes (17,21,25). T. denticola ATCC 33520 shares more than 76% DNA similarity with ATCC 35405 (7). However, these two strains possess many physiological and genetic differences, such as serotype (7, 8), oxygen tolerance (46), and biofilm formation capability (24,48,49). In addition, four plasmids have been isolated from several oral...

show abstract

Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Cited by 21 publications

References 9 publications

Alzheimer's disease - a neurospirochetosis. Analysis of the evidence following Koch's and Hill's criteria

Alzheimer's disease - a neurospirochetosis. Analysis of the evidence following Koch's and Hill's criteria

A Modified Shuttle Plasmid Facilitates Expression of a Flavin Mononucleotide-Based Fluorescent Protein in Treponema denticola ATCC 35405

Disruption of a Type II Endonuclease (TDE0911) Enables Treponema denticola ATCC 35405 To Accept an Unmethylated Shuttle Vector

Contact Info

Product

Resources

About