Cellular localization and dynamics of the Mrr type IV restriction endonuclease of <i>Escherichia coli</i>

Ghosh, Anirban; Passaris, Ioannis; Mebrhatu, Mehari Tesfazgi; Rocha, Susana; Vanoirbeek, Kristof; Hofkens, Johan; Aertsen, Abram

doi:10.1093/nar/gkt1370

Cited by 8 publications

(20 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Briefly, the MG1655 chromosomal mrr locus was first replaced by a tetA-sacB cassette (yielding MG1655 Δmrr::tetA-sacB ) obtained from a polymerase chain reaction (PCR) amplicon (using primers 5΄-TAGTGCTATAGTAGCCGAAAAACATCTACCTGATTCTGCAAG GATGTACTTCCTAATTTTTGTTGACACTCTATC-3΄ and 5΄-AAGGGGTTATGGGCCGGATAAGGCGC AGCCGCATCCGGCCTGATATTTCAATCAAAGGGAAAACTGTCCATATGC-3΄ on genomic DNA of E. coli T-Sack ( 17 )), after which this tetA-SacB cassette was replaced by the gfp-mrr construct of interest using Tet/SacB counter-selection media ( 17 ). For construction of the E. coli MG1655 P mrr -gfp::mrr strain, chromosomally expressing the GFP-Mrr fusion protein from the native mrr promoter, the chromosomal Δmrr::tetA-sacB allele was replaced with the gfp::mrr allele obtained from a PCR amplicon prepared on the pBAD- gfp::mrr vector (( 9 ); using primers 5΄-ATTTTTGTAGTGCTATAGTAG CCGAAAAACATCTACCTGATTCTGCAAGGATGTACTATGAGTAAAGGAGAAGAAC-3΄ and 5΄-CGAT AAGCTTG CGTTTGCGGGGTTGAGG -3΄). For construction of the E. coli K12 MG1655 P BAD -gfp::mrr strain, chromosomally expressing the GFP-Mrr fusion protein from an arabinose inducible promoter, the chromosomal Δmrr::tetA-sacB allele was replaced with the P BAD -gfp::mrr allele obtained from a PCR amplicon prepared on the pBAD- gfp::mrr vector ( 9 ) (using primers 5΄-ATTTTTGTAGTGCTAT AGTAGCCGAAAAACATCTACCTGATTCTGCAAGGATGTACTTTATGAC AACTTGACGGCTA-3΄ and 5΄-CGATAAGCTTGCGTTTGCGGGGTTGAGG-3΄).…”

Section: Methodsmentioning

confidence: 99%

“…While Mrr can harmlessly be expressed in cells under atmospheric conditions, fluorescence microscopy has shown that its activation by HP causes nucleoid condensation and concomitant confinement of nucleoid associated Mrr proteins (9). HP activation of Mrr triggers a RecA-dependent SOS response, underscoring that active Mrr causes double strand breaks in the host nucleoid (8).…”

Section: Introductionmentioning

confidence: 99%

“…Surprisingly, it was documented previously as well, that a sub-lethal hydrostatic pressure shock (HP∼100 MPa for ∼15 min) is also able to trigger Mrr-dependent DNA damage in its E. coli K-12 (strain MG1655) host ( 7 , 8 ). While Mrr can harmlessly be expressed in cells under atmospheric conditions, fluorescence microscopy has shown that its activation by HP causes nucleoid condensation and concomitant confinement of nucleoid associated Mrr proteins ( 9 ). HP activation of Mrr triggers a RecA-dependent SOS response, underscoring that active Mrr causes double strand breaks in the host nucleoid ( 8 ).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

High pressure activation of the Mrr restriction endonuclease in Escherichia coli involves tetramer dissociation

Bourges

Montaguth

Ghosh

et al. 2017

Nucleic Acids Research

Self Cite

View full text Add to dashboard Cite

A sub-lethal hydrostatic pressure (HP) shock of ∼100 MPa elicits a RecA-dependent DNA damage (SOS) response in Escherichia coli K-12, despite the fact that pressure cannot compromise the covalent integrity of DNA. Prior screens for HP resistance identified Mrr (Methylated adenine Recognition and Restriction), a Type IV restriction endonuclease (REase), as instigator for this enigmatic HP-induced SOS response. Type IV REases tend to target modified DNA sites, and E. coli Mrr activity was previously shown to be elicited by expression of the foreign M.HhaII Type II methytransferase (MTase), as well. Here we measured the concentration and stoichiometry of a functional GFP-Mrr fusion protein using in vivo fluorescence fluctuation microscopy. Our results demonstrate that Mrr is a tetramer in unstressed cells, but shifts to a dimer after HP shock or co-expression with M.HhaII. Based on the differences in reversibility of tetramer dissociation observed for wild-type GFP-Mrr and a catalytic mutant upon HP shock compared to M.HhaII expression, we propose a model by which (i) HP triggers Mrr activity by directly pushing inactive Mrr tetramers to dissociate into active Mrr dimers, while (ii) M.HhaII triggers Mrr activity by creating high affinity target sites on the chromosome, which pull the equilibrium from inactive tetrameric Mrr toward active dimer.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

High pressure activation of the Mrr restriction endonuclease in Escherichia coli involves tetramer dissociation

Bourges

Montaguth

Ghosh

et al. 2017

Nucleic Acids Research

Self Cite

View full text Add to dashboard Cite

show abstract

“…al., 2001). Whilst, StyLT2Mrr was primarily recognized as an enzyme conferring genotoxicity on heterologous expression of some exotic type II MTases in E. coli K12 (Ghosh et. al., 2014).…”

Section: Restriction-modification Systems (Rms)mentioning

confidence: 99%

Whole genome analysis and characterization of Salmonella enterica subsp. enterica serovar Typhimurium strain UPM 260 for mediated genetic manipulation

Ns¹,

Nm²,

Ar³

et al. 2020

Preprint

View full text Add to dashboard Cite

Background Salmonella enterica serovar Typhimurium persists as one of the most frequent food-borne zoonoses, causing a major public health concern worldwide. Furthermore, Salmonella infection has a large economic impact. Globally, the main sources of infection for humans include the consumption of contaminated poultry meat and eggs. In animals however, Salmonella transmission usually occurs horizontally from infected birds and contaminated environments. Hence, to delve further on how the impact of this disease can be lessened, an epidemiological study needs to be performed. It is vital to determine the genomic sequences of microorganisms to understand their biology and functional characterization. Thus, we determined the whole-genome sequence and virulence profile of S. enterica serovar Typhimurium strain UPM 260 isolated from Perak, Malaysia. Whole genome sequencing (WGS) using paired-end sequencing generated 107 contigs with a total genome size of 4.9 Mbp and 52% G+C content. The contigs were annotated for phylogenetic and functional analysis. Results Through the analysis, it is revealed that the genome were resistant to a number of antimicrobial drug classes including aminoglycoside, fluoroquinolone, tetracycline and phenicol. Also found in UPM 260 genome were three intact prophages (Fels-1, Gifsy-2 and one unique prophage, mEp390). The genome housed four types of restriction-modification systems (RMS) and Type I-E subtype of CRISPR-Cas system. Two metal resistance operons (mer and cop) and six pathogenicity islands (SPIs) were also discovered in UPM 260 genome. The SPIs contributed mostly to the bacterial virulence properties since 1054 CDS were reported to be homologous to the virulence factors in the database VFDB. Conclusion This study benefits us specifically in the field of genome engineering where gene-based genetic manipulations can be applied in reducing the prevalence and pathogenicity in Salmonella.

show abstract

“…The response of E. coli to pressure was stronger than for the other two microbes ( The MG1655 reference strain of E. coli used in these experiments harbored a pressureactivated restriction endonuclease, Mrr, which leads to a pressure-induced SOS response (15,23,24). To ascertain whether response of E. coli metabolism to pressure was linked to this Mrrinduced SOS response, we carried out FLIM/Phasor analysis on the auto-fluorescence of an E.…”

Section: Microbial Metabolic Responses To Pressurementioning

confidence: 99%

Quantitative high-resolution imaging of live microbial cells at high hydrostatic pressure

Bourges

Lazarev

Declerck

et al. 2019

Preprint

View full text Add to dashboard Cite

ABSTRACTThe majority of the Earth’s microbial biomass exists in the Deep Biosphere, in the deep ocean and within the Earth’s crust. While other physical parameters in these environments, such as temperature or pH, can differ substantially, they are all under high-pressures. Beyond emerging genomic information, little is known about the molecular mechanisms underlying the ability of these organisms to survive and grow at pressures that can reach over 1000-fold pressure on the Earth’s surface. The mechanisms of pressure adaptation are also important to in food safety, with the increasing use of high-pressure food processing. Advanced imaging represents an important tool for exploring microbial adaptation and response to environmental changes. Here we describe implementation of a high-pressure sample chamber with a 2-photon scanning microscope system allowing for the first time, quantitative high-resolution two-photon imaging at 100 MPa of living microbes from all three kingdoms of life. We adapted this setup for Fluorescence Lifetime Imaging Microscopy with Phasor analysis (FLIM/Phasor) and investigated metabolic responses to pressure of live cells from mesophilic yeast and bacterial strains, as well as the piezophilic archaeon, Archaeoglobus fulgidus. We also monitored by fluorescence intensity fluctuation-based methods (scanning Number and Brightness (sN&B) and Raster scanning Imaging Correlation Spectroscopy (RICS)) the effect of pressure on the chromosome-associated protein HU and on the ParB partition protein in E. coli, revealing partially reversible dissociation of ParB foci and concomitant nucleoid condensation.SIGNIFICANCEThe majority of the Earth’s microbial biomass exists in high-pressure environments where pressures can reach over 100 MPa. The molecular mechanisms that allow microbes to flourish under such extreme conditions remain to be discovered. The high pressure, high resolution imaging system presented here revealed pressure dependent changes in metabolism and protein interactions in live microbial cells, demonstrating great promise for understanding deep life.

show abstract

Cellular localization and dynamics of the Mrr type IV restriction endonuclease of Escherichia coli

Cited by 8 publications

References 46 publications

High pressure activation of the Mrr restriction endonuclease in Escherichia coli involves tetramer dissociation

High pressure activation of the Mrr restriction endonuclease in Escherichia coli involves tetramer dissociation

Whole genome analysis and characterization of Salmonella enterica subsp. enterica serovar Typhimurium strain UPM 260 for mediated genetic manipulation

Quantitative high-resolution imaging of live microbial cells at high hydrostatic pressure

Contact Info

Product

Resources

About