Cell proliferation and expression of the transferrin receptor gene: promoter sequence homologies and protein interactions.

Miskimins, W. Keith; McClelland, Alan; Roberts, M P; Ruddle, Frank H.

doi:10.1083/jcb.103.5.1781

Cited by 66 publications

(42 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…All three stable cell lines initiated DNA synthesis between 8 and 12 h and reached a maximum level around 18 h post serum stimulation. Thus, all of the cell lines responded to serum in nearly identical manners and retained the temporal pattern of the parental 3T3 cell line (28).…”

Section: Methodsmentioning

confidence: 92%

“…The boxes labelled A and B represent regions of the promoter that were previously shown to be protected by factors from HeLa nuclear extracts in DNase I footprinting experiments (3,26,28). Both sites have sequences that are similar to the consensus recognition sites of known transcription factors.…”

Section: Methodsmentioning

confidence: 99%

“…We found two elements that are protected in DNase I footprinting experiments (3,26,28). These protein recognition sites are indicated by the boxes labelled A and B in Fig.…”

mentioning

confidence: 94%

See 2 more Smart Citations

A mitogen-responsive promoter region that is synergistically activated through multiple signalling pathways.

Ouyang¹,

Bommakanti²,

Miskimins³

1993

Mol. Cell. Biol.

Self Cite

View full text Add to dashboard Cite

A regulatory region of the human transferrin receptor gene promoter was found to be required for increased expression in response to serum or growth factors. This region contains two elements that appear to cooperate for full responsiveness. We found that sodium orthovanadate treatment of cells significantly activated expression of promoter constructs containing these elements. 12-0-Tetradecanoylphorbol-13-acetate alone induced a twofold increase in expression but acted synergistically with vanadate to generate a highly elevated level of expression. Dibutyryl cyclic AMP alone had no effect on expression, but when added together with vanadate and 12-0-tetradecanoylphorbol-13-acetate, led to superinduction of the promoter construct. Induction of expression by these reagents was delayed several hours, and the kinetics were identical to those observed for serum induction.Transferrin receptors (TR) mediate uptake of iron into cells by binding and endocytosis of transferrin. Expression of TR is coupled to cell proliferation, and blocking of receptor function prevents cells from entering the S phase. This is most likely the result of an increased need for iron during the DNA-synthetic phase of the cell cycle. Rapidly proliferating cells have elevated levels of TR compared with quiescent, noncycling cells (13,22). When quiescent cells are activated by growth factors or mitogens, the level of cell surface TR increases. Increased expression of TR in mitogen-activated cells involves increased transcription of the TR-encoding gene (21). This is a delayed response that occurs several hours after mitogen stimulation and reaches a maximum just prior to entry into the S phase.Previously we have characterized the promoter region of the TR-encoding gene and analyzed the DNA-protein interactions within this region. We found two elements that are protected in DNase I footprinting experiments (3,26,28). These protein recognition sites are indicated by the boxes labelled A and B in Fig. 1A. Element A is GC rich and contains a consensus binding sequence for transcription factor Spl. However, we have demonstrated that multiple factors can interact within this region (26). Element B contains a sequence that is similar to the sequences recognized by both the Apl and cyclic AMP (cAMP) response element-binding protein (CREB) families of transcription factors. Microinjection of oligonucleotides that span both elements A and B was able to block serum induction of DNA synthesis (27). However, oligonucleotides for either site alone had no effect. These results suggest that the factors that recognize these sequences in the TR promoter have cooperative effects that are critical for the signalling pathways involved in transition to the S phase.

show abstract

Section: Methodsmentioning

confidence: 92%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

A mitogen-responsive promoter region that is synergistically activated through multiple signalling pathways.

Ouyang¹,

Bommakanti²,

Miskimins³

1993

Mol. Cell. Biol.

Self Cite

View full text Add to dashboard Cite

show abstract

“…20 Expression of TfR1 is regulated at the levels of transcription and posttranscription by factors such as cellular status of iron, oxygen, proliferation, and differentiation. [21][22][23][24][25][26] Expression profiles of TfR1 and TfR2 in response to cellular iron status were also different. Intracellular iron levels regulate expression of TfR1 mainly at a posttranscriptional level.…”

Section: Discussionmentioning

confidence: 99%

Regulation of expression of murine transferrin receptor 2

Kawabata

Germain

Ikezoe

et al. 2001

Blood

126

118

View full text Add to dashboard Cite

Complementary and genomic DNA for the murine transferrin receptor 2 (TfR2) were cloned and mapped to chromosome 5. Northern blot analysis showed that high levels of expression of murine TfR2 occurred in the liver, whereas expression of TfR1 in the liver was relatively low. During liver development, TfR2 was up-regulated and TfR1 was down-regulated. During erythrocytic differentiation of murine erythroleukemia (MEL) cells induced by dimethylsulfoxide, expression of TfR1 increased, whereas TfR2 decreased. In MEL cells, expression of TfR1 was induced by desferrioxamine, an iron chelator, and it was reduced by ferric nitrate. In contrast, levels of TfR2 were not affected by the cellular iron status. Reporter assay showed that GATA-1, an erythroid-specific transcription factor essential for erythrocytic differentiation at relatively early stages, enhanced TfR2 promoter activity. Interestingly, FOG-1, a cofactor of GATA-1 required for erythrocyte maturation, repressed the enhancement of the activity by GATA-1. Also, CCAAT-enhancer binding protein, which is abundant in liver, enhanced the promoter activity. Thus, tissue distribution of TfR2 was consistent with the reporter assays. Expression profiles of TfR2 were different from those of TfR1, suggesting unique functions for TfR2, which may be involved in iron metabolism, hepatocyte function, and erythrocytic differentiation. IntroductionIron, one of the essential elements of life, is carried by transferrin (Tf) in the serum and absorbed by the cells through transferrin receptor (TfR1)-mediated mechanisms. 1 Diferric Tf in the serum binds to TfR1 on the cell surface, followed by endocytosis of the receptor-ligand complex. HFE is an atypical major histocompatibility complex (MHC) class I molecule that can form a complex with TfR1 on the cell surface and interfere with binding of Tf to TfR1. [2][3][4] Mutations of HFE are thought to be related to hereditary hemochromatosis. After internalization of the Tf-TfR1 complex, iron is released from the Tf-TfR1 complex in the endosome and is transported to the cytoplasm and mitochondria by DMT1/Nramp2, a transmembrane iron transporter. [5][6][7][8] Recently, we cloned human TfR2, another transferrin receptor gene. Two alternatively spliced forms of human TfR2 transcripts were identified: ␣ and ␤. TfR2-␣ was highly expressed in K562, an erythroid leukemia cell line; in liver; and in HepG2, a hepatoma cell line. 9 Increased Tf binding and iron uptake were observed in Chinese hamster ovary cells that had been stably transfected with human TfR2-␣. Although human TfR2-␣ and TfR1 are very similar in their primary structure and Tf-binding property, the expression pattern of TfR2 mRNA is quite different from that of TfR1. We have found that in K562 cells, iron chelation up-regulates TfR1 and down-regulates TfR2, and iron overload down-regulates TfR1 and slightly up-regulates TfR2. 10 TfR1 knockout mice did not survive beyond embryonic day 12.5 because of severe anemia and neurologic abnormalities, which indicates that murine TfR2 cannot ...

show abstract

“…Previous reports have suggested that this sequence may be recognized by a T-cell-specific DNAbinding protein (14). The 5' flanking region also contains a 20-bp sequence (GGGGCGGGCCGGGGCGGGGCTC) (bp -75 to -54) which is present in a similar location in the thymidine kinase gene (12), the dihydrofolate reductase (DHFR) gene (41), and the transferring receptor (TR) gene (Table 1) (30). This sequence is very G+C rich and contains two tandemly arrayed potential binding sites for the Spl transcription factor (GGGGCGG) (10).…”

mentioning

confidence: 99%

Isolation and structural characterization of the human 4F2 heavy-chain gene, an inducible gene involved in T-lymphocyte activation.

Gottesdiener¹,

Karpinski²,

Lindsten³

et al. 1988

Mol. Cell. Biol.

View full text Add to dashboard Cite

show abstract

Cell proliferation and expression of the transferrin receptor gene: promoter sequence homologies and protein interactions.

Cited by 66 publications

References 42 publications

A mitogen-responsive promoter region that is synergistically activated through multiple signalling pathways.

A mitogen-responsive promoter region that is synergistically activated through multiple signalling pathways.

Regulation of expression of murine transferrin receptor 2

Isolation and structural characterization of the human 4F2 heavy-chain gene, an inducible gene involved in T-lymphocyte activation.

Contact Info

Product

Resources

About