cDNA sequence and chromosomal localization of the mouse parvalbumin gene,Pva

Abstract

In the homozygous condition, the mutation adr (arrested development of righting response) of the mouse causes a myotonia and a drastic reduction of the Ca 2+ -binding protein parvalbumin (PV) in fast muscles. Using a rat PV probe, a mouse cDNA clone was isolated from a Agtll wild-type fast-muscle library and its nucleotide sequence was determined. The protein coding and the 3' nontranslated regions of the mouse gene show extensive homology with the rat PV gene. The result of Southern blot hybridization is consistent with a single copy gene for parvalbumin. Restriction fragment length polymorphisms (RFLPs) between Mus musculus domesticus (e.g. C57BL/6) and Mus spretus (SPE) were detected with the enzymes Eco RI, Pst I, and Sst I. The restriction fragment patterns of DNA samples from 65 individual offspring of (C57BL/6 x SPE)F1 x C57BL/6 backcrosses were tested with the PV probe and matched, for linkage detection, to pre-existing patterns established with various RFLP probes on the same samples. A co-distribution of PVRFLPs with Pvt-1 and Mlvi-2, which had been localized on chromosome 15, was detected. Thus, the structural gene for PV, designated Pva, maps to chromosome 15 of the mouse whereas the adr mutation shows no linkage with markers on this chromosome. Gene locus homology between chromsome 15 of the mouse and chromosome 22 of man (which carries the human PV gene) is discussed.

Opposite Regulation of Calbindin and Calretinin Expression by Brain‐Derived Neurotrophic Factor in Cortical Neurons

“…The 490‐bp calretinin cDNA fragment was obtained by RT and PCR amplification of total RNA from cultured cortical neurons with a set of oligonucleotide primers (5′ ‐TGCTTCAGGCAGCACGTGGG‐3′ and 5′ ‐CAATCTCCAGGTCCTTTCTG‐3′) located at 59‐78 and 529‐548 bp, respectively, in the coding region of the mouse calretinin cDNA sequence (Ellis and Rogers, 1993). The 333‐bp parvalbumin cDNA fragment was obtained by RT and PCR amplification of total RNA from adult mouse brain with a set of oligonucleotide primers (5′ ‐ATGTCGATGACAGACGTGCT‐3′ and 5′ ‐TTACGTTTCAGCCACCAGAG‐3′) located at 1‐20 and 314‐333 bp, respectively, in the coding region of the mouse parvalbumin cDNA sequence (Zuhlke et al, 1989).…”

Expression of nerve-regulated genes in muscles of mouse mutants affected by spinal muscular atrophies and muscular dystrophies

“…ant., tibialis anterior. albumin (PV), a 700-bp mouse cDNA from the coding region of mouse parvalbumin 44,52 ; and ␣-actin, a 500-bp cDNA from the coding region of human skeletal ␣-actin.…”

Characterization of parvalbumin cDNA clones and gene expression in normal and dystrophic mice of strain 129 ReJ

“…2 and 3). Both PVA-1 (392 bp) and PVA-2 (1268 bp) coded for 103 amino acids in a sequence identical to a mouse PV cDNA clone isolated previously, which coded for 110 amino acids (Zuhlke et al 1989). The main differences in PVA-1 and PVA-2 compared with the previously described mouse PVA clone were that PVA-1 and PVA-2 lacked sequences at the 3' end; however, both clones contained sequences 5' to the translational start site not found in the previous cDNA clone.…”

“…Clone PVA-1 was found to contain an insert 392 b p long with an incomplete ORF, from which the deduced amino acid sequence was found to be identical with a cDNA isolated previously from muscle of a normal, wild-type mouse (A2G) (Zuhlke et al 1989). However, PVA-1 was found to lack the proper termination and polyadenylation signals and coded for a protein with 103 amino acids compared with PV in the mouse, which has 110 amino acids (Zuhlke et al 1989). Biochem.…”

“…1986), human (Berchtold 1989), mouse (Zuhlke et al 1989;Schleef e t al. 1992), and other species (Schwartz and Kay 1988) have been cloned and characterized to varying extents, relatively little is known about the regulation of Pva expression i n dystrophic animals.…”