c-kit Is Expressed in Soft Tissue Sarcoma of Neuroectodermic Origin and Its Ligand Prevents Apoptosis of Neoplastic Cells

Ricotti, Emanuela; Fagioli, Franca; Garelli, Emanuela; Linari, Claudia; Crescenzio, Nicoletta; Horenstein, Alberto L.; Pistamiglio, Paola; Vai, Sergio; Berger, Massimo; diMontezemolo, Luca Cordero; Madon, E; Basso, Giuseppe

doi:10.1182/blood.v91.7.2397

Cited by 90 publications

(28 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…After an overnight incubation, cells were placed for 1 hr in medium with 5 μM AE. Cells were then washed twice in cold PBS and fixed with 1% paraformaldehyde for 15 min at 4°C as described previously 26. After washing with cold PBS, cells were resuspended in 70% ethanol at 4°C and stored at −20°C until used.…”

Section: Methodsmentioning

confidence: 99%

Involvement of p53 in specific anti‐neuroectodermal tumor activity of aloe‐emodin

Pecere

Sarinella

Salata

et al. 2003

Intl Journal of Cancer

View full text Add to dashboard Cite

Previously, we have identified aloe-emodin (AE) as a new type of anticancer agent, with activity that is based on apoptotic cell death promoted by a neuroectodermal tumorspecific drug uptake. We attempt to clarify the intracellular target of AE and the apoptosis-signaling pathway activated by AE in neuroblastoma cell lines. Two-photon excitation microscopy and spectroscopic titrations documented that AE is highly concentrated in susceptible cells and binds to DNA. One of the most important mediators of apoptotic response to genotoxic stimuli, such as anticancer agents, is the p53 tumor suppressor gene. To evaluate the role played by p53 in AE-induced apoptosis a p53 mutant cell line, which lacks transcriptional activity of p53 targeted genes, was tested. AE displayed a reduced growth inhibitory and proapoptotic activity in p53 mutant cells (SK-N-BE(2c)) with respect to the p53 wild-type line (SJ-N-KP). This effect was not caused by a reduced drug uptake in the mutant neuroblastoma cell line but was related to a different apoptotic cell phenotype. Whereas SJ-N-KP cells were susceptible to a p53 transcription-dependent pathway of apoptosis, SK-N-BE(2c) cells underwent apoptosis with up-regulation of p53 expression but not of p53-target genes. After AE treatment p53 translocates to the mitochondria inter-membrane space in both neuroblastoma cell lines. Due to its high accumulation in neuroectodermal tumor cells AE could also kill tumor cells harboring p53 mutant genes. This property would further contribute to AE specific anti-tumor activity and might be exploitable in the clinic.

show abstract

Section: Methodsmentioning

confidence: 99%

Involvement of p53 in specific anti‐neuroectodermal tumor activity of aloe‐emodin

Pecere

Sarinella

Salata

et al. 2003

Intl Journal of Cancer

View full text Add to dashboard Cite

show abstract

“…The c-Kit mRNA expression was evaluated using the primers (Ricotti et al, 1998) 5′ forward GAGTTGGCCCTAGAAGTTAGA 5′ reverse CCTGGAGGTGGATGCAAGTT at the following conditions: 40 cycles at 94˚C for 1 min., 64˚C for 45 s, 72˚C for 1 min.…”

Section: C-kit and Scf Pcrmentioning

confidence: 99%

c-KIT and c-KIT ligand (SCF) in synovial sarcoma (SS): an mRNA expression analysis in 23 cases

et al. 2001

View full text Add to dashboard Cite

In a previous immunophenotypic molecular-based analysis it was shown that bcl2 over-expression characterizes the SS gene profile in addition to the non-random translocations. Here we show that the over-expression of an additional potentially antiapoptotic gene, the c-KIT gene, is associated with this tumour. Interestingly, whereas bcl2 over-expression appears to be restricted to the spindle cell tumoral component, c-kit mainly involves the epithelial component of biphasic SS. Twenty-three primary and metastatic samples from 21 patients were analysed by immunophenotyping (23/23), immunoprecipitations and Western blotting (3/23), and RT-PCR (23/23). Ten cases were biphasic and 13 monophasic in sub-type. Twelve, 10 and 1 case carried the SYT-SSX1, SYT-SSX2 and SYT-SSX4 fusion transcript, respectively. Co-presence of both c-Kit and SCF mRNA was observed in almost all cases (20/23), suggesting the occurrence of an autocrine loop. Immunophenotyping, confirmed by biochemical analyses, showed a modulation of c-Kit expression which was faint in the spindle and strong in the epithelial component, respectively. The study was complemented by c-Met/HGF receptor/ligand expression and c-Met protein analysis with results superimposable to those already reported. Since in each tumour, epithelial and spindle cell components harbour the same type of translocation t(X;18) the present findings suggest a shifting of the anti-apoptotic role from BCL2 to c-KIT gene during the transition from the uncommitted spindle to the differentiated epithelial cells. © 2001 Cancer Research Campaign http://www.bjcancer.com

show abstract

“…Compared with the protein extracted from a pool of healthy tissues, higher levels of PDGFRa and PDGFRb expression were detected, respectively, in 6 of 10 (cases 3, 4, 5, 6, 12, and 15; Table 1) and 7 of 10 (cases 1, 3,4,6,8,9,15; Table 1) ESFT-positive samples; all these cases had a stronger phosphorylation signal.…”

Section: Biochemical Analysismentioning

confidence: 98%

“…The spliced form lacking the cleavage site remains associated with the cell surface (membrane-associated), whereas the other (soluble) form is rapidly released. The pathological autocrine/paracrine loop sustained by a constitutive KIT dimerization was first identified in ESFT cell lines 3,4 and primary tumor specimens. 5 Imatinib was subsequently proposed in combination with standard therapy with a view to inhibiting KIT activation.…”

mentioning

confidence: 99%

Evidence for activation of KIT, PDGFRα, and PDGFRβ receptors in the Ewing sarcoma family of tumors

Bozzi

Tamborini

Negri

et al. 2007

Cancer

View full text Add to dashboard Cite

BACKGROUND. The Ewing sarcoma family of tumors (ESFT) is one of the most common malignant neoplasms of children and adolescents, characterized by nonrandom translocations involving the Ewing sarcoma (EWS) gene. Over the years the adoption of intensive multimodality treatment approaches has led to a gradual improvement in the survival of patients with ESFT. The prognosis is still unsatisfactory for high‐risk patients, however, and novel therapeutic approaches are desirable. The aim of the study was to investigate the expression/activation of KIT, PDGFRα, and PDGFRβ receptor tyrosine kinases (RTKs) as potential therapeutic targets in ESFT. METHODS. RNA and proteins were extracted from 20 frozen ESFT specimens to ascertain the state activation of KIT, PDGFRα, and PDGFRβ. RESULTS. No mutations were found, whereas the cognate ligands were detected in all cases by polymerase chain reaction (PCR). The expression and activation of KIT, PDGFRα, and PDGFRβ were confirmed by quantitative PCR, immunohistochemistry, and immunoprecipitation and/or Western blot analysis. In particular, when compared with a protein pool obtained from normal adult tissues, PDGFRβ showed a greater protein expression and/or a stronger phosphorylation signal. CONCLUSIONS. The results are consistent with an autocrine/paracrine loop activation of the KIT, PDGFRα, and PDGFRβ receptors and suggest a rationale for the use of RTK inhibitors, either alone or in combination with chemotherapy. Cancer 2007. © 2007 American Cancer Society.

show abstract

c-kit Is Expressed in Soft Tissue Sarcoma of Neuroectodermic Origin and Its Ligand Prevents Apoptosis of Neoplastic Cells

Cited by 90 publications

References 18 publications

Involvement of p53 in specific anti‐neuroectodermal tumor activity of aloe‐emodin

Involvement of p53 in specific anti‐neuroectodermal tumor activity of aloe‐emodin

c-KIT and c-KIT ligand (SCF) in synovial sarcoma (SS): an mRNA expression analysis in 23 cases

Evidence for activation of KIT, PDGFRα, and PDGFRβ receptors in the Ewing sarcoma family of tumors

Contact Info

Product

Resources

About