BOX-PCR is an adequate tool for typing of clinical &lt;i&gt;Pseudomonas aeruginosa&lt;/i&gt; isolates

Wolska, Katarzyna; Kot, Barbara; Jakubczak, A.; Rymuza, Katarzyna

doi:10.5603/fhc.2011.0098

Cited by 8 publications

(4 citation statements)

References 10 publications

(16 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The use of 272 and 208 primers was successful in discrimination of different Pseudomonas isolates described before ( 28 ). Although Nagaveni et al ( 51 ) showed that ERIC PCR provided an exceptionally qualitative discrimination for pseudomonads, the results of our and similar studies ( 52 , 53 ), showed the advantage of BOX PCR, as it confirmed the results obtained with 272 RADP PCR.…”

Section: Resultssupporting

confidence: 83%

Phenotypic and genetic properties of susceptible and multidrug-resistant Pseudomonas aeruginosa isolates in Southern Serbia

Milojković

Nenadović

Stanković

et al. 2020

Archives of Industrial Hygiene and Toxicology

View full text Add to dashboard Cite

Drug resistance of Pseudomonas aeruginosa is a leading problem in hospital infections. The aim of this study was to determine the best molecular genetic discrimination method for Pseudomonas spp. isolates among 94 outpatients and inpatients and see their grouping by phenotype characteristics (biofilm formation, frequency of serotypes, pigmentation, production of different class of beta-lactamases, and susceptibility to different antibiotic classes) and genotype. The most common serotypes were P1, P6, and P11, while co-productions of pyoverdine and pyocyanin were observed in 70 % of isolates. A total of 77.66 % isolates were mostly weak and moderate biofilm producers. Isolates were susceptible to colistin (100 %), aztreonam (97.87 %), imipenem (91.49 %), doripenem (90.43 %), and meropenem (84.04 %). MICs values confirmed susceptibility to ceftazidime and cefepime and singled out meripenem as the most effective inhibitor. Most isolates were resistant to aminoglycosides and fluoroquinolones. Only two isolates produced ESBL, eight were carbapenemase producers, and five isolates produced MBLs. Twenty-nine isolates were multidrug-resistant; 82.8 % of which produced both pigments, 58.3 % were non-typeable, while the P6 and P11 serotypes were equally distributed (16.7 %). Thirteen MDR isolates were strong enzyme producers. RAPD PCR analysis using primer 272 proved the best at discriminatory fingerprinting for Pseudomonas isolates, as it allocated 12 clusters. A correlation between DNA patterns and antibiotic resistance, production of pigments, serotypes distribution, and biofilm formation was not observed, and only confirmed higher genetic heterogeneity among P. aeruginosa isolates, which suggests that other molecular methods are needed to reveal potential relations between genotypic patterns and phenotypic characteristics.

show abstract

Section: Resultssupporting

confidence: 83%

Phenotypic and genetic properties of susceptible and multidrug-resistant Pseudomonas aeruginosa isolates in Southern Serbia

Milojković

Nenadović

Stanković

et al. 2020

Archives of Industrial Hygiene and Toxicology

View full text Add to dashboard Cite

show abstract

“…BOX-PCR produced a larger number (6) of duplicate profiles (Figure 4 ), i.e., a larger number of identical strains, than the number (3) obtained from ERIC-PCR (Figure 3 ). Previous studies gave similar degrees of heterogeneity by application of rep-PCR analysis in groups of isolated Pseudomonas strains (Selvakumar et al, 2009 ; Vyas et al, 2009 ; Wolska et al, 2011 ).…”

Section: Resultsmentioning

confidence: 72%

Analysis of Plant Growth-Promoting Effects of Fluorescent Pseudomonas Strains Isolated from Mentha piperita Rhizosphere and Effects of Their Volatile Organic Compounds on Essential Oil Composition

et al. 2016

View full text Add to dashboard Cite

Many species or strains of the genus Pseudomonas have been characterized as plant growth promoting rhizobacteria (PGPR). We used a combination of phenotypic and genotypic techniques to analyze the community of fluorescent Pseudomonas strains in the rhizosphere of commercially grown Mentha piperita (peppermint). Biochemical techniques, Amplified rDNA Restriction Analysis (ARDRA), and 16S rRNA gene sequence analysis revealed that the majority of the isolated native fluorescent strains were P. putida. Use of two Repetitive Sequence-based PCR (rep-PCR) techniques, BOX-PCR and ERIC-PCR, allowed us to evaluate diversity among the native strains and to more effectively distinguish among them. PGPR activity was tested for the native strains and reference strain P. fluorescens WCS417r. Micropropagated M. piperita plantlets were exposed to microbial volatile organic compounds (mVOCs) emitted by the bacterial strains, and plant biomass parameters and production of essential oils (EOs) were measured. mVOCs from 11 of the native strains caused an increase in shoot fresh weight. mVOCs from three native strains (SJ04, SJ25, SJ48) induced changes in M. pierita EO composition. The mVOCs caused a reduction of metabolites in the monoterpene pathway, for example menthofuran, and an increase in menthol production. Menthol production is the primary indicator of EO quality. The mVOCs produced by native strains SJ04, SJ25, SJ48, and strain WCS417r were analyzed. The obtained mVOC chromatographic profiles were unique for each of the three native strains analyzed, containing varying hydrocarbon, aromatic, and alogenic compounds. The differential effects of the strains were most likely due to the specific mixtures of mVOCs emitted by each strain, suggesting a synergistic effect occurs among the compounds present.

show abstract

“…ERIC and BOX fingerprinting were used for typing strains of different Pseudomonas species (Wolska et al, ). These methods generates characteristic genome profiles that help to differentiate between closely related bacterial strains (Abdellatif et al, ; Rombouts et al, ).…”

Section: Resultsmentioning

confidence: 99%

“…The rep‐PCR fingerprinting analysis was carried out using the genomic DNA from each strain and primer sets BOXA1R (5′‐CTACGGCAAGGCGACGCTGACG‐3′) (Martin et al, ) and E1 (5'‐ATGTAAGCTCCTGGGGATTCAC‐3') and E2 (5'‐AAGTAAGTGACTGGGGTGACGG‐3') (Versalovic, Schneider, de Bruijn, & Lupski, ), corresponding to BOX and ERIC elements, respectively. The PCR protocol was adapted from Wolska, Kot, Jakubczak, and Rymuza (). Amplification was carried out in a total volume reaction of 50 µl containing 1× PCR Taq Reaction Buffer (Thermo Fisher Scientific), 2.5 mM dNTP, 2.5 mM MgCl 2 , 2 µM of each primer, 150 ng genomic DNA template and 1.25 unit Taq DNA Polymerase (Thermo Fisher Scientific).…”

Section: Methodsmentioning

confidence: 99%

Identification and genetic diversity analysis of strain Pseudomonas syringae S5: A pathogen responsible for bacteriosis in Avena sativa plants

Primo

Santoro

Giordano

et al. 2019

Journal of Phytopathology

View full text Add to dashboard Cite

The genus Pseudomonas includes pathogenic species P. syringae, which can be found in various agricultural environments and which can affect a wide variety of plants, causing significant economic losses when the environmental conditions for its proliferation are optimal. Comprehensive characterizations of phytopathogenic bacteria belonging to the genus Pseudomonas are scarce in Argentina. In this work, the tabtoxin-producing strain Pseudomonas S5, isolated from oat, was identified as a P. syringae through biochemical tests such as the LOPAT test, and genetic tests such as the analysis of the small subunit ribosomal RNA gene (16S rRNA) sequence and repetitive elements, using BOX and ERIC primers. It was also determined that this phytopathogen is potentially capable of infecting other crops of agricultural importance for our region, such as soybean. This ability to infect different hosts gives it an adaptive advantage that allows it to endure seasonal changes in the environment where it lives.Our work contributes to the physiological classification of the phytopathogen P. syringae S5 isolated from our region, as well as to the knowledge about its range of potential hosts. K E Y W O R D S16S rRNA gene, bacteriosis, BOX-PCR, oat, Pseudomonas syringae | 147 PRIMO et al.

show abstract

BOX-PCR is an adequate tool for typing of clinical <i>Pseudomonas aeruginosa</i> isolates

Cited by 8 publications

References 10 publications

Phenotypic and genetic properties of susceptible and multidrug-resistant Pseudomonas aeruginosa isolates in Southern Serbia

Phenotypic and genetic properties of susceptible and multidrug-resistant Pseudomonas aeruginosa isolates in Southern Serbia

Analysis of Plant Growth-Promoting Effects of Fluorescent Pseudomonas Strains Isolated from Mentha piperita Rhizosphere and Effects of Their Volatile Organic Compounds on Essential Oil Composition

Identification and genetic diversity analysis of strain Pseudomonas syringae S5: A pathogen responsible for bacteriosis in Avena sativa plants

Contact Info

Product

Resources

About