Beta-Hemolysin Promotes Skin Colonization by Staphylococcus aureus

Abstract

Colonization by Staphylococcus aureus is a characteristic feature of several inflammatory skin diseases and is often followed by epidermal damage and invasive infection. In this study, we investigated the mechanism of skin colonization by a virulent community-acquired methicillin-resistant S. aureus (CA-MRSA) strain, MW2, using a murine ear colonization model. MW2 does not produce a hemolytic toxin, beta-hemolysin (Hlb), due to integration of a prophage, Sa3mw, inside the toxin gene (hlb). However, we found that strain MW2 bacteria that had successfully colonized murine ears included derivatives that produced Hlb. Genome sequencing of the Hlb-producing colonies revealed that precise excision of prophage Sa3mw occurred, leading to reconstruction of the intact hlb gene in their chromosomes. To address the question of whether Hlb is involved in skin colonization, we constructed MW2-derivative strains with and without the Hlb gene and then subjected them to colonization tests. The colonization efficiency of the Hlb-producing mutant on murine ears was more than 50-fold greater than that of the mutant without hlb. Furthermore, we also showed that Hlb toxin had elevated cytotoxicity for human primary keratinocytes. Our results indicate that S. aureus Hlb plays an important role in skin colonization by damaging keratinocytes, in addition to its well-known hemolytic activity for erythrocytes.

“Slow VISA,” a Novel Phenotype of Vancomycin Resistance, Found In Vitro in Heterogeneous Vancomycin-Intermediate Staphylococcus aureus Strain Mu3

“…For the chromosomal allele replacement of rpoB(R512P) in S. aureus strain N315 or N315⌬IP (⌬IP), we used the pKOR1 allele replacement system, as described previously (8,9). In brief, a 1,884-bp sequence of rpoB insert DNA encompassing a 1-kb flanking sequence of a phage attachment site was generated by PCR from the chromosomal DNA of strain 6R-P using the primers attB1-rpoB (5=-GGGGACAAGTTTGTA CAAAAAAGCAGGCTAAATGGATATTCTGTTATAGTTATATAA TA-3=) and attB2-rpoB (5=-GGGG ACCACTTTGTACAAGAAAGCTGGG TCCAGAATCACGTGCTGCAACGTGTTCCA-3=).…”

Membrane-damaging and cytotoxic sphingomyelinases and phospholipases

“…They are classified according to their site of action upon the hydrolysis of the acyl ester bond: PLases A 1 [EC 3. [195] • Cytotoxic to polymorphonuclear leukocytes, monocytes, and T-lymphocytes [34,41] • Inhibits IL-8 expression, impairing neutrophil migration [196] • Aids in bacterial tissue colonization and damage [195,197] • Participates in biofilm formation [ • Triggers bacterium escape from vacuoles [55] Note: Sphingomyelin (SM); ceramide (Cer); phosphatidylcholine (PC); lysophosphatidylcholine (LPC), lysophosphatidic acid (LPA).…”

Phospholipases during membrane dynamics in malaria parasites

“…SMases C were also shown to play an important role in bacterial virulence, e.g. for Bacillus cereus (Oda et al, 2014(Oda et al, , 2012, Staphylococcus aureus (Hayashida et al, 2009;Huseby et al, 2010;Katayama et al, 2013) or Listeria ivanovii (Gonzalez-Zorn et al, 1999). The SMase C inhibitor SMY-540 exhibits a strong inhibitory effect against B. cereus and significantly reduces lethality of B. cereusinfected mice (Oda et al, 2014).…”