AphidBase: a centralized bioinformatic resource for annotation of the pea aphid genome

Legeai, Fabrice; Shigenobu, Shuji; Gauthier, Jean-Pierre; Colbourne, John K.; Rispe, Claude; Collin, Olivier; Richards, Stephen; Wilson, Adam C.; Murphy, Terence; Tagu, Denis

doi:10.1111/j.1365-2583.2009.00930.x

Cited by 109 publications

(96 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Gene identification E(spl)-C genes were identified using BLASTP or TBLASTN searches (Altschul et al 1990) on whole insect genome sequence databases (BeetleBase, http://www.bioinformatics.ksu.edu/BeetleBase; I. scapularis VectorBase, http://www.vectorbase.org; Nasonia Genome Project, http://www.hgsc.bcm.tmc.edu/projects/nasonia/; P. humanus VectorBase, http://www.vectorbase.org; wFleaBase: Daphnia Genome project, http://wfleabase.org/; Colbourne et al 2005;Wang et al 2005Wang et al , 2007Nene et al 2007;Drysdale 2008;Tribolium Genome Sequencing Consortium 2008;Lawson et al 2009; The International Aphid Genomics Consortium 2010; Legeai et al 2010; The Nasonia Genome Working Group 2010). When E(spl)-C bHLH genes were identified we searched the regions around those genes using BLAST searches against the Drosophila genome to identify other possible components of a complex.…”

Section: Methodsmentioning

confidence: 99%

Evolution of a genomic regulatory domain: The role of gene co-option and gene duplication in the Enhancer of split complex

Duncan¹,

Dearden²

2010

Genome Res.

View full text Add to dashboard Cite

The Drosophila Enhancer of split complex [E(spl)-C] is a remarkable complex of genes many of which are effectors or modulators of Notch signaling. The complex contains different classes of genes including four bearded genes and seven basic helix-loop-helix (bHLH) genes. We examined the evolution of this unusual complex by identifying bearded and bHLH genes in the genome sequences of Arthropods. We find that a four-gene E(spl)-C, containing three bHLH genes and one bearded gene, is an ancient component of the genomes of Crustacea and Insects. The complex is well conserved in insects but is highly modified in Drosophila, where two of the ancestral genes of the complex are missing, and the remaining two have been duplicated multiple times. Through examining the expression of E(spl)-C genes in honeybees, aphids, and Drosophila, we determined that the complex ancestrally had a role in Notch signaling. The expression patterns of genes found inserted into the complex in some insects, or that of ancestral E(spl)-C genes that have moved out of the complex, imply that the E(spl)-C is a genomic domain regulated as a whole by Notch signaling. We hypothesize that the E(spl)-C is a Notch-regulated genomic domain conserved in Arthropod genomes for around 420 million years. We discuss the consequence of this conserved domain for the recruitment of novel genes into the Notch signaling cascade.

show abstract

Section: Methodsmentioning

confidence: 99%

Evolution of a genomic regulatory domain: The role of gene co-option and gene duplication in the Enhancer of split complex

Duncan¹,

Dearden²

2010

Genome Res.

View full text Add to dashboard Cite

show abstract

“…2 P/N 4303859, 1997) (Silva et al, 2012) and the two best reference genes were selected with the NormFinder algorithm (Legeai et al, 2010). Among glyceraldehyde-3-phosphate dehydrogenase GADPH (DW011095), cyclophilin-10-like (EC388830), actin (EE262754), ribosomal protein LP0 (DW011949) and ribosomal protein L7 (DW361765), NormFinder identified GADPH (for primers details see Silva et al, 2012) as the most stable expressed housekeeping gene followed by cyclophilin-10-like.…”

Section: Analysis Of Mpfor Gene Expressionmentioning

confidence: 99%

“…and M. p. nicotianae, respectively) as template for the amplification of mpfor. Specific primers for mpfor (forward: 5 0 AGTACGGACTTCGCTTTCAC 3 0 ; reverse: 5 0 GCAAGATAGGAGGAGTTAGG 3 0 ) were designed based on the predicted sequences from the aphid Acyrthosiphon pisum recovered from Aphidbase(Legeai et al, 2010) (Gbrowse accession numbers: for orthologous ACYPI008877-RA, ID ¼ XM 001952056), using the software Primer Premiere v.5.0 1 (PREMIER Biosoft International, Palo Alto, CA, U.S.A.). The PCR for mpfor was performed in a total volume of 25 ml containing 10 mM dNTPs, 2.0 mM Mg2þ, 10 mM of each primer, 1 ml of template cDNA and 0.50 U of Pfu Ultra II Fusion HS DNA polymerase (Stratagene) in lX polymerase chain reaction buffer.…”

mentioning

confidence: 99%

Differences in learning and memory of host plant features between specialist and generalist phytophagous insects

et al. 2015

View full text Add to dashboard Cite

“…We used the number of 'undefined' calls, that is, polymorphic positions in the genome for which the genotype could not be determined by UnifiedGenotyper, as a proxy for alignment success. Finally, the gene content of these regions has been established using the version 2.1 of the official gene set of the pea aphid provided by AphidBase (Legeai et al, 2010).…”

Section: Identification and Analysis Of Potentially Divergent Regionsmentioning

confidence: 99%

Whole-genome re-sequencing of non-model organisms: lessons from unmapped reads

et al. 2014

View full text Add to dashboard Cite

Unmapped reads are often discarded from the analysis of whole-genome re-sequencing, but new biological information and insights can be uncovered through their analysis. In this paper, we investigate unmapped reads from the re-sequencing data of 33 pea aphid genomes from individuals specialized on different host plants. The unmapped reads for each individual were retrieved following mapping to the Acyrthosiphon pisum reference genome and its mitochondrial and symbiont genomes. These sets of unmapped reads were then cross-compared, revealing that a significant number of these unmapped sequences were conserved across individuals. Interestingly, sequences were most commonly shared between individuals adapted to the same host plant, suggesting that these sequences may contribute to the divergence between host plant specialized biotypes. Analysis of the contigs obtained from assembling the unmapped reads pooled by biotype allowed us to recover some divergent genomic regions previously excluded from analysis and to discover putative novel sequences of A. pisum and its symbionts. In conclusion, this study emphasizes the interest of the unmapped component of re-sequencing data sets and the potential loss of important information. We here propose strategies to aid the capture and interpretation of this information. Heredity (2015) 114, 494-501; doi:10.1038/hdy.2014.85; published online 1 October 2014 INTRODUCTION Next-generation sequencing and whole-genome re-sequencing is nowadays commonly used to identify genomic variants that underlie phenotypic variations, genetic diseases, adaptation or speciation in natural populations. Typically, the reads are mapped against a reference genome, and the genotypes (that is, single-nucleotide polymorphism (SNP) and structural variant calls) are based on these mapped reads (Altshuler et al., 2010;Nielsen et al., 2011). In addition to universal caveats regarding unknown insertions and/or genomic contamination, which can be overlooked in pure mapping approaches, non-model organisms may suffer from the poor quality of the nuclear reference genome and incomplete symbiont or organellar genomes. Moreover, mapping is constrained by the level of divergence between the reads and the available reference sequence (Sousa and Hey, 2013). The resulting ascertainment bias could be problematic, especially when studying adaptation or speciation processes, as genomic regions of interest are expected to display important levels of divergence. These different issues produce a non-negligible fraction of unmapped reads, whose sequences are generally disregarded in favor of the mapped reads in the subsequent steps of the analysis, despite potentially containing useful information. This study offers one strategy for mining the unmapped reads in order to extract the relevant biological knowledge, leading to advice and recommendations for other re-sequencing projects.We investigated this question in the context of a large-scale resequencing project on the pea aphid species complex. The pea aphid

show abstract

AphidBase: a centralized bioinformatic resource for annotation of the pea aphid genome

Cited by 109 publications

References 35 publications

Evolution of a genomic regulatory domain: The role of gene co-option and gene duplication in the Enhancer of split complex

Evolution of a genomic regulatory domain: The role of gene co-option and gene duplication in the Enhancer of split complex

Differences in learning and memory of host plant features between specialist and generalist phytophagous insects

Whole-genome re-sequencing of non-model organisms: lessons from unmapped reads

Contact Info

Product

Resources

About