Ammonia-oxidizing bacteria and archaea in wastewater treatment plant sludge and nearby coastal sediment in an industrial area in China

Abstract

Under the increasing pressure of human activities, Hangzhou Bay has become one of the most seriously polluted waters along China's coast. Considering the excessive inorganic nitrogen detected in the bay, in this study, the impact of an effluent from a coastal industrial park on ammonia-oxidizing microorganisms (AOMs) of the receiving area was interpreted for the first time by molecular technologies. Revealed by real-time PCR, the ratio of archaeal amoA/bacterial amoA ranged from 5.68 × 10(-6) to 4.79 × 10(-5) in the activated sludge from two wastewater treatment plants (WWTPs) and 0.54-3.44 in the sediments from the effluent receiving coastal area. Analyzed by clone and pyrosequencing libraries, genus Nitrosomonas was the predominant ammonia-oxidizing bacteria (AOB), but no ammonia-oxidizing archaea (AOA) was abundant enough for sequencing in the activated sludge from the WWTPs; genus Nitrosomonas and Nitrosopumilus were the dominant AOB and AOA, respectively, in the coastal sediments. The different abundance of AOA but similar structure of AOB between the WWTPs and nearby coastal area probably indicated an anthropogenic impact on the microbial ecology in Hangzhou Bay.

Archaeal nitrification is constrained by copper complexation with organic matter in municipal wastewater treatment plants

“…Pristine ecosystems, such as most soils and marine environments, are dominated by AOA rather than AOB [3,4], whereas the opposite relative abundances are commonly observed for engineered environments, including activated sludge systems of most municipal WWTPs [9][10][11] and in eutrophic lakes [6,8] and fertilized terrestrial environments [7]. Because several AOA strains were reported to be inhibited in pure culture by organic compounds (Table S1), we hypothesized that organic matter may be a key factor affecting the activity and competitive success of AOA populations in natural and man-made environments, including WWTPs.…”

“…AOA outnumber their bacterial counterparts in many oligotrophic terrestrial and marine habitats [3][4][5] often by several orders of magnitude, while AOB populations typically dominate under eutrophic conditions [6][7][8]. Consistently, AOB control ammonia oxidation in almost all municipal and many industrial WWTPs [9][10][11]. However, interestingly in certain industrial wastewater treatment These authors contributed equally: Joo-Han Gwak, Man-Young Jung systems, in some municipal activated sludge systems with low ammonia effluent values and in some municipal plants employing alternatives to activated sludge-based systems AOA dominance has been described [12][13][14][15], but the actual factors causing this unusual composition of the nitrifying community are unknown.…”

Quantitative and qualitative studies of microorganisms involved in full‐scale autotrophic nitrogen removal performance

“…For the amplification of archaeal amoA gene the primers Arch‐ amoA F (5′‐STAATGGTCTGGCTTAGA‐3′) and Arch‐ amoA R (5′‐GCGGCCATCCATCTGTATGT‐3′) were used, while the primer pair amoA ‐1F (5′‐GGGGTTTCTACTGGTGGT‐3′)‐ amoA ‐1R (5′‐CCCCTCKGSAAAGCCTTCTTC‐3′) was chosen for the massive parallel sequencing of bacterial amoA . The PCR conditions for the amoA genes were: 120 s at 94°C, then 30 cycles of: 30 s at 95°C, 35 s at 55°C, and 30 s a 72°C, followed by 300 s at 72°C for Archaea; 120 s at 94°C, then 30 cycles of: 30 s at 95°C, 30 s at 55°C, and 30 s a 72°C, followed by 300 s at 72°C for Bacteria . The Roche 454 GS‐FLX+ equipment was utilized for this task.…”

“…To conduct the ecological study, the samples of archaeal and bacterial amoA were rarified and cut to 1297 and 4450 sequences, respectively. After this, for each subsample, the sequences were clustered into OTUs a 97 and 95% similarity threshold for Bacteria and Archaea domains, respectively, and then a representative sequence of each OTU was affiliated using phylogenetic analysis, which was calculated using MEGA7 software with 1000 bootstrap replications under the Jukes‐Cantor substitution model. The phylogenetic trees are shown in the Supporting Information (Figure S1–S8).…”

Ecophysiology and Comparative Genomics of Nitrosomonas mobilis Ms1 Isolated from Autotrophic Nitrifying Granules of Wastewater Treatment Bioreactor

“…Studies on nitrifying microbes in wastewater treatment systems and the natural environment using molecular methods have indicated that Nitrosomonas species are the main AOB populations in wastewater treatment bioreactors (Tsuneda et al, 2003; Chen and Wong, 2004; Mota et al, 2005; Wells et al, 2009), as well as in diverse natural environments including freshwater, coastal and brackish water regions (Stehr et al, 1995; Zhang et al, 2015). Among Nitrosomonas species, Nitrosomonas europaea / Nitrosomonas mobilis cluster 7 was dominant in wastewater treatment bioreactors loaded with high concentrations of ammonia and nitrite, whereas Nitrosomonas oligotropha cluster 6a was dominant in systems with a lower ammonia environment (Suwa et al, 1994, 1997; Bollmann and Laanbroek, 2001; Limpiyakorn et al, 2005, 2007; Tan et al, 2008).…”