Abstract A05: NKG2D and CD28 receptors differentially activate mTOR to alter murine effector CD8+ T cell differentiation

Abstract

Memory CD8+ T cells are an essential component of anti-tumor and anti-viral immunity. Activation of the mammalian/mechanistic target of rapamycin (mTOR) pathway has been implicated in regulating the differentiation of effector and memory T cells. However, the mechanisms that control mTOR activity during immunity to tumors and infections are not well known. Activation of costimulatory receptors, including CD28 and NKG2D, activate PI3K and subsequently may activate the mTOR pathway in CD8+ T cells. Therefore this study compared the activation of the mTOR signaling pathway after costimulation through CD28 or NKG2D receptors in murine effector CD8+ T cells. Compared to CD28 costimulation, activation through CD3 and NKG2D receptors had weaker activation of mTORc1 as shown by decreased phosphorylation of mTORc1 targets S6K1, ribosomal protein S6, and 4EBP-1. NKG2D costimulation also showed increased gene expression of TSC2, a negative regulator of mTORc1, whereas CD28 costimulation increased gene expression of Rheb, an activator of mTORc1, and HIF-1α and VEGFα, pro-angiogenic factors downstream of mTORc1. Strong mTORc1 activation in CD28-costimulated cells also increased expression of transcription factors that support effector cell differentiation, namely T-bet, and BLIMP1, whereas low levels of mTORc1 activation allowed for the expression of Eomes and BCL6 during NKG2D stimulation, and increased expression of central memory markers CD62L and CD127. These data show that compared to CD28, costimulation through the NKG2D receptor leads to the differential activation of the mTOR signaling pathway and potentially supports memory CD8+ T cell differentiation. Citation Format: Bryan McQueen, Kelsey Trace, Emily Whitman, Amorette Barber. NKG2D and CD28 receptors differentially activate mTOR to alter murine effector CD8+ T cell differentiation. [abstract]. In: Proceedings of the Fourth AACR International Conference on Frontiers in Basic Cancer Research; 2015 Oct 23-26; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2016;76(3 Suppl):Abstract nr A05.

Adoptive transfer of murine T cells expressing a chimeric‐PD1‐Dap10 receptor as an immunotherapy for lymphoma

“…CD28‐containing CARs often induce an effector memory or effector cell phenotype and do not live as long in vivo whereas CARs that induce a central memory phenotype usually persist longer in vivo and often have stronger anti‐tumour efficacy . Stimulation of natural killer group 2D (NKG2D)/Dap10 has recently been shown to induce a central memory phenotype in murine effector CD8 cells, so the differentiation phenotype of chPD1‐Dap10 and chPD1‐CD28 T cells was compared . When cultured with RMA cells, chPD1‐CD28 T cells increased the gene expression of transcription factors involved in effector cell differentiation, T‐bet and BLIMP‐1, whereas chPD1‐Dap10 T cells increased the expression of transcription factors that support central memory differentiation, Eomes and BCL‐6 (Fig.…”

“…This could potentially be caused by the induction of a central memory phenotype and enhanced in vivo survival of the chPD1‐Dap10 T cells. Stimulation of NKG2D/Dap10 has recently been shown to induce a central memory phenotype in murine effector CD8 cells in part due to differential activation of mTOR . Interestingly, mTOR activates specific metabolic pathways in T cells such as aerobic glycolysis and compared with CD28 co‐stimulation, activation through NKG2D/Dap10 shows weaker activation of mTOR .…”

“…Maxima SYBRGreen qPCR Master Mix (Thermo Scientific, Waltham, MA) and gene specific primers were used: β ‐actin F 5′‐GTGTGATGGTGGGAATGGGTCAGA‐3′, β ‐actin R 5′‐TACGACCAGAGGCATACAGGGACA, PDL1 F 5′‐GCTCCAAAGGACTTGTACGTG‐3′, PDL1 R 5′‐TGATCTGAAGGGCAGCATTTC‐3′, PDL2 F 5′‐CTGCCGATACTGAACCTGAGC‐3′, PDL2 R 5′‐GCGGTCAAAATCGCACTC‐3′. Gene‐specific primers for T‐cell differentiation genes T‐bet, BLIMP1, Eomes and BCL6 were previously described . Primers were purchased from Integrated DNA Technologies (Coralville, IA).…”

“…CD28 and Dap10 activate many similar pathways including phosphatidylinositol‐3 kinase, AKT/Protein Kinase B and mitogen‐activate protein kinases . However, CD28 and Dap10 stimulation seem to have unique effects on effector T cells, including differential activation of signal transduction pathways including β ‐catenin, nuclear factor‐ κ B and mammalian target of rapamycin (mTOR), leading to dissimilar cytokine secretion and T‐cell differentiation . Specifically, when compared with CD28, co‐stimulation through Dap10 induces CD8 T‐cell memory differentiation and secretion of pro‐inflammatory but not anti‐inflammatory cytokines, both of which seem to be preferable characteristics for successful CAR T‐cell therapy .…”

T Cells Going Innate

“…While downstream signaling pathways of NKG2D involve the same adaptor molecule linked to CD28, inducing the PI3K/mTOR signaling cascade, activation of NKG2D/TCR in contrast to CD28/TCR has recently been suggested to increase the formation of memory precursor CD8 + T cells based on intermediate levels of mTOR complex 1 (mTORc1) activation [15]. Interestingly, augmented co-stimulation through NKG2D has also been shown to rescue memory CD8 + T cell responses in the absence of CD4 + T cell help, mainly dependent on IL-15 [16].…”