A tobacco nuclear extract supporting transcription, processing, splicing and modification of plant intron‐containing tRNA precursors

Abstract

SummaryNuclear tRNA genes are transcribed by RNA polymerase III (Pol III) and pre-tRNAs are processed into mature tRNAs via complex processes in the nucleus. We have developed an in vitro Pol III-dependent transcription system derived from tobacco cultured cells, which supports ef®ciently not only transcription of a variety of plant tRNA genes but also 5¢-and 3¢-end processing, nucleotide modi®cation and splicing of intron-containing pre-tRNAs. The structures of in vitro transcripts have been con®rmed by primer extension analysis and by RNase T1 ®ngerprinting. The optimal Mg 2+ concentration differed for each step so that each reaction can be controlled by adjusting the Mg 2+ concentration. At 1 mM Mg 2+ , only transcription occurs so that pre-tRNAs accumulate. The splicing reaction can be initiated by raising Mg 2+ ions (> 5 mM) and enhanced by adding 1 mM hexamminecobalt chloride. Using the optimized system for the Nicotiana intron-containing tRNA Tyr gene, the precise initiation and termination sites of transcription and the splice sites were determined. The presence of 1 mM NAD + in the reaction mixture leads to the removal of the 2¢-phosphate at the splice junction of tRNA Tyr , demonstrating the activity of a 2¢-phosphotransferase in the tobacco nuclear extract. Many modi®ed nucleosides such as m 2 G, m 2 2 G, m 1 A, Y27 and Y35 are introduced in either of the studied transcripts. As shown in other systems, the conversion of U35 to Y requires an intron-containing substrate.

tRNA transfers to the limelight

“…The yeast ligation pathway is known to require two components: tRNA ligase (Trl1p), to join the excised exons forming a splice junction 2Ј-phosphate , and the 2Ј-phosphotransferase Tpt1p to transfer the phosphate to NAD to form ADP-ribose 1Љ-2Љ-cyclic phosphate (Culver et al 1993;Spinelli et al 1997). Similar ligase activities have been found in plants and humans (Konarska et al 1982;Pick and Hurwitz 1986;Zillman et al 1991), and Tpt1p activity or functional orthologs have been found widely in plants, vertebrates, and archaea (Zillman et al 1992;Spinelli et al 1998;Yukawa et al 2001). However, the ligation pathway in some organisms may involve a completely different ligase, first discovered some time ago in vertebrates (Nishikura and De Robertis 1981;Filipowicz and Shatkin 1983;Laski et al 1983), that does not produce a 2Ј-phosphate junction.…”

A new in vitro translation system for non‐radioactive assay from tobacco chloroplasts: effect of pre‐mRNA processing on translation in vitro

“…The quality of extracted RNA was tested on a 4% acrylamide/8 m urea gel. Primer extension analysis was carried out as described previously (Yukawa et al. , 2001) using 200 ng RNA and an FITC‐labelled primer (5′‐GGGACAACTCCAGTGAAAAGTTCTTCTC‐3′) complementary to the mGFP coding region.…”

Visualizing bz1 missense suppression in Zea mays: an assay for monocot tRNA expression and utilization

“…A tobacco nuclear extract that supports transcription, processing, splicing and modification of tRNAs has been developed (Yukawa et al 1997;Yukawa et al 2000;Yukawa et al 2001) but separation and characterization of the biochemical activities has not been described, nor have similar systems been described in monocots.…”