A Fast and Cost-Effective Method for Identifying a Polymorphism of Interleukin 28B Related to Hepatitis C

Ferreira, Camila da Silva; Abreu, Rodrigo Martins; Silva, Marlone Cunha da; Ferreira, Aline Siqueira; Nasser, Paulo Dominguez; Carrilho, Flair José; Ono, Suzane Kioko

doi:10.1371/journal.pone.0078142

Cited by 5 publications

(4 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The single-nucleotide polymorphism (SNP) rs12979860 in the region of the interleukin 28B (IL28B) gene was analyzed using confronting two-pair primers as previously described 13 .…”

Section: Testing For Snps Of Il28bmentioning

confidence: 99%

Profile of HIV subtypes in HIV/HBV- and HIV/HCV-coinfected patients in Southern Brazil

Avanzi

Vicente

Beloto

et al. 2017

Rev. Soc. Bras. Med. Trop.

View full text Add to dashboard Cite

Introduction: HIV and viral hepatitis infections are major causes of chronic disease worldwide and have some similarities with regard to routes of transmission, epidemiology, front barriers faced during access of treatment, and strategies for a global public health response. The objective was to describe the HIV-1 subtypes, viral tropism and single-nucleotide polymorphisms (SNPs) of interleukin 28B (IL28B) from a case series of HIV/viral hepatitis coinfected patients from southern Brazil. Methods: Clinical and epidemiological data were evaluated by a review of medical records. Periodic blood draws were taken to determine the viral and host characteristics. Results: This study included 38 patients with HIV/HBV or HIV/HCV coinfection; the median age was 49 years. Thirty-seven (97.4%) were on antiretroviral therapy, 32 (84.2%) had an undetectable viral load, a median CD4 + T-cell count of 452 cells/mm 3 . HIV-1 subtyping showed 47.4 and 31.6% of patients with subtypes C and B, respectively. Analysis of viral co-receptor usage showed a predominance of the R5 variant (64.7%), with no significant difference between the subtypes. Twenty patients with HIV/HCV coinfection were eligible to receive HCV therapy with pegylated-interferon-alpha plus ribavirin, and 10/20 (50%) of them achieved sustained virological response. SNPs of IL28B were evaluated in 93.3% of patients with HIV/ HCV coinfection, and 17 (60.7%) presented the CC genotype. Conclusions: In the present case series, a higher frequency of HIV subtype C was found in coinfected patients. However such findings need to be prospectively evaluated with the inclusion of data from regional multicenter analyses.

show abstract

“…The single-nucleotide polymorphism (SNP) rs12979860 in the region of the interleukin 28B (IL28B) gene was analyzed using confronting two-pair primers as previously described 13 .…”

Section: Testing For Snps Of Il28bmentioning

confidence: 99%

Profile of HIV subtypes in HIV/HBV- and HIV/HCV-coinfected patients in Southern Brazil

Avanzi

Vicente

Beloto

et al. 2017

Rev. Soc. Bras. Med. Trop.

View full text Add to dashboard Cite

show abstract

“…Frozen whole blood was used for IL-28B genotyping after genomic DNA extraction using QIAamp DNA Blood Mini kit (Qiagen). IL-28B genotyping was performed by PCR with confronting two-pair primers (CTPP) PCR as described previously [15]. The primer sequences used for IL-28B were (F1: GACGAGAGGGCGTTAGAGCG, R1: GGAGTGCAATTCAACCCTGGTTCG; F2: GAGCTCCCCGAAGGCGT, R2: AACGCAGGCTCAGGGTCAAT) [15].…”

Section: Methodsmentioning

confidence: 99%

“…IL-28B genotyping was performed by PCR with confronting two-pair primers (CTPP) PCR as described previously [15]. The primer sequences used for IL-28B were (F1: GACGAGAGGGCGTTAGAGCG, R1: GGAGTGCAATTCAACCCTGGTTCG; F2: GAGCTCCCCGAAGGCGT, R2: AACGCAGGCTCAGGGTCAAT) [15]. The reactions consisted of a total volume of 50 µl containing 1·5 U Hotstart DNA polymerase (Takara, China), 0·5 µ m of primers F1, F2, and R2, 0·75 µ m of primer R1, 1·0 µ m dNTP and 50 ng genomic DNA.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The treatment of HCV in patients with haemoglobinopathy in Kurdistan Region, Iraq: a single centre experience

et al. 2015

View full text Add to dashboard Cite

Various variables that might influence the rapid and sustained virological response to recombinant PEG-IFN-α-2a were explored in Iraqi HCV-infected patients with haemoglobinopathy. Forty-three patients were evaluated for the relationship between rapid virological response (RVR), IL-28B polymorphism, viral load, liver enzyme levels, blood group, ultrasound findings, or HCV genotype and the sustained virological response (SVR) achievement. The overall RVR was 55·81% while the overall SVR was 53·49%. SVR in patients that achieved RVR was 82·61% (P = 0·0004). A significant association was found between initial alanine transaminase levels and viral load with SVR achievement (P = 0·025) and (P = 0·004), respectively. Thirty-two (74%) out of 43 of our samples were host genotyped at the IL-28B locus as CC, a significant association was found between CC group and SVR achievement (P = 0·04). Of our samples, 23/43 (53%) were typed as HCV genotype 4, 10/43 (23%) as genotype 1, 9/43 (20·9%) as genotype 3 and 1/43 (2·3%) as genotype 2. A significant association was found between genotype 3 and SVR achievement (P = 0·006). Multivariate analysis showed that only RVR achievement independently associated with SVR in the Iraqi population (P = 0·00). These results can be used to classify the patients requiring the more expensive new direct-acting antiviral drugs.

show abstract

Comparison of four methods of genotyping IL28B polymorphisms in chronic hepatitis C patients

Delvaux

Costa

et al. 2015

Journal of Virological Methods

View full text Add to dashboard Cite

A Fast and Cost-Effective Method for Identifying a Polymorphism of Interleukin 28B Related to Hepatitis C

Cited by 5 publications

References 17 publications

Profile of HIV subtypes in HIV/HBV- and HIV/HCV-coinfected patients in Southern Brazil

Profile of HIV subtypes in HIV/HBV- and HIV/HCV-coinfected patients in Southern Brazil

The treatment of HCV in patients with haemoglobinopathy in Kurdistan Region, Iraq: a single centre experience

Comparison of four methods of genotyping IL28B polymorphisms in chronic hepatitis C patients

Contact Info

Product

Resources

About