A Common Copy Number Variation (CNV) Polymorphism in the CNTNAP4 Gene: Association with Aging in Females

Abstract

BackgroundAging is a biological process strongly determined by genetics. However, only a few single nucleotide polymorphisms (SNPs) have been reported to be consistently associated with aging. While investigating whether copy number variations (CNVs) could fill this gap, we focused on CNVs that have not been studied in previous SNP-based searches via tagging SNPs.MethodsTaqMan qPCR assays were developed to quantify 20 common CNVs in 222 senior American Caucasians in order to reveal possible association with longevity. The replication study was comprised of 1283 community-dwelling senior European Caucasians. Replicated CNVs were further investigated for association with healthy aging and aging-related diseases, while association with longevity was additionally tested in Caenorhabditis elegans.ResultsIn the discovery study of ≥80 vs.<80 years old seniors, a homozygous intronic CNV deletion in the CNTNAP4 gene was inversely associated with survival to the age of 80 (OR=0.51, 95%CI 0.29-0.87, p=0.015 before correction for multiple testing). After stratification by sex, association remained significant in females (OR=0.41, 95%CI 0.21-0.77, p=0.007), but not in males (OR=0.97, 95%CI 0.33-2.79, p=1). The finding was validated in a replication study (OR=0.66, 95%CI 0.48-0.90, p=0.011 for females). CNTNAP4 association with longevity was supported by a marked 25% lifespan change in C. elegans after knocking down the ortholog gene. An inverse association of the CNV del/del variant with female healthy aging was observed (OR=0.39, 95%CI 0.19-0.76, p=0.006). A corresponding positive association with aging-related diseases was revealed for cognitive impairment (OR=2.17, 95%CI 1.11-4.22, p=0.024) and, in independent studies, for Alzheimer’s (OR=4.07, 95%CI 1.17-14.14, p=0.036) and Parkinson’s (OR=1.59, 95%CI 1.03-2.42, p=0.041) diseases.ConclusionThis is the first demonstration for association of the CNTNAP4 gene and one of its intronic CNV polymorphisms with aging. Association with particular aging-related diseases awaits replication and independent validation.

Copy number variation associates with mortality in long‐lived individuals: a genome‐wide assessment

“…In total, they identified three deletions and four duplications that were significantly enriched in the pediatric individuals and that primarily encompassed genes involved in RNA splicing, suggesting an impact of this biological mechanism on lifespan (Glessner et al ., 2013). Recently, an analysis of the association between 20 common CNVs not typically covered by commercial arrays and longevity in 222 senior American Caucasians with replication in 1283 community‐dwelling senior European Caucasians resulted in the identification of a deletion in the neurexin superfamily member CNTNAP4 on chromosome 16q23.1 that was inversely associated with survival to 80 years in women (Iakoubov et al ., 2013). Further investigation of CNVs in other gene members of the neurexin superfamily by the same group additionally led to the detection of a CNV in the CNTNAP2 gene on chromosome 7q35‐36.1 that negatively associated with healthy aging in octogenarian men (Iakoubov et al ., 2015).…”

A Common Copy Number Variation Polymorphism in the <b><i>CNTNAP2</i></b> Gene: Sexual Dimorphism in Association with Healthy Aging and Disease

“…The selection method for our proprietary list of about 200 CNVs, all with no tagging SNPs present in the most popular SNP-based arrays used in past genome-wide association studies, was previously described [2]. Three CNVs harbored by the CNTNAP2, NRXN1, and NRXN3 genes from the neurexin superfamily were found in this list and examined in the current study (table 1).…”

“…Primer-probe sequences for the quantification of the CNTNAP2 esv11910 CNV (classification is based on the NCBI dbVar database) were: forward 5′CCCGATCAATGCAAATTCTATTT3′, reverse 5′GGGCCAGCACCTGAAGCT3′, probe 5′CCAAGAGGCCCAGATGACCAGCC3′. Primers for reference controls and for genotyping the esv12669 CNV in the CNTNAP4 gene (CNVR6782.1, in previous classification) were described by Iakoubov et al [2]. All primers and probes were custom-ordered from Biosearch Technologies Inc. (Novato, Calif., USA).…”

“…In a recent publication [2], 20 individual polymorphisms randomly selected from our proprietary list of about 200 common CNVs were investigated for association with human aging. CNV polymorphisms on the list have not been previously investigated due to the absence of tagging single nucleotide polymorphisms (SNPs) in the arrays that have been used in past genome-wide association studies.…”

“…Here, three CNVs with an intronic location within neurexin superfamily genes CNTNAP2 , NRXN1 , and NRXN3 (table 1) were identified in our proprietary list of CNVs and tested for association with aging. Taking into account the sexual dimorphism that is characteristic for association of some neurexins with diseases [2,6], in all the experiments, after analyzing the data for men and women combined, an additional analysis was performed for each sex separately in order not to miss sex-specific associations.…”