9-Cis Retinoic Acid Promotes Lymphangiogenesis and Enhances Lymphatic Vessel Regeneration

Abstract

Background The lymphatic system plays a key role in tissue fluid homeostasis and lymphatic dysfunction due to genetic defects or lymphatic vessel obstruction can cause lymphedema, disfiguring tissue swellings often associated with fibrosis and recurrent infections without available cures to date. In this study, retinoic acids (RAs) were determined to be a potent therapeutic agent that is immediately applicable to reduce secondary lymphedema. Methods and Results We report that RAs promote proliferation, migration and tube formation of cultured lymphatic endothelial cells (LECs) by activating FGF-receptor signaling. Moreover, RAs control the expression of cell-cycle checkpoint regulators such as p27Kip1, p57Kip2 and the aurora kinases through both an Akt-mediated non-genomic action and a transcription-dependent genomic action that is mediated by Prox1, a master regulator of lymphatic development. Moreover, 9-cisRA was found to activate in vivo lymphangiogenesis in animals based on mouse trachea, matrigel plug and cornea pocket assays. Finally, we demonstrate that 9-cisRA can provide a strong therapeutic efficacy in ameliorating the experimental mouse tail lymphedema by enhancing lymphatic vessel regeneration. Conclusions These in vitro and animal studies demonstrate that 9-cisRA potently activates lymphangiogenesis and promotes lymphatic regeneration in an experimental lymphedema model, presenting it as a promising novel therapeutic agent to treat human lymphedema patients.

FGF2-induced Ras/Erk MAPK signalling maintains lymphatic endothelial cell identity by up-regulating endothelial cell-specific gene expression and suppressing TGFβ signalling via Smad2

“…However, the results suggest that FGF2 is the primary factor involved in maintaining endothelial cell marker expression and plays a unique role in the suppression of mesenchymal markers expression in mLECs. Next, we confirmed that fibroblast growth factor receptors (FGFRs) are expressed in LECs at the mRNA level, as described previously (Cao et al, 2012;Choi et al, 2012;Kazenwadel et al, 2012;Matsuo et al, 2007;Shin et al, 2006). We checked FGFR expression by real-time RT-PCR, using mLECs cultured in EGM2, and pre-optimised TaqMan expression assays.…”

“…2B). The lymphangiogenic activity of FGF2 has been demonstrated in vivo and in vitro (Cao et al, 2012;Chang et al, 2004;Choi et al, 2012;Kazenwadel et al, 2012;Kubo et al, 2002;Matsuo et al, 2007;Pepper et al, 1994;Shin et al, 2006), but the role of FGF2 in EndMT of LECs has not been studied previously. Therefore, we focused on the anti-EndMT activity of FGF2 in LECs.…”

“…Two distinct mechanisms underlying FGF2-induced lymphangiogenesis have been suggested. One mechanism is that FGF2 directly activates FGFRs on LECs, leading to lymphangiogenic responses such as proliferation, migration and tube-like morphogenesis of LECs (Cao et al, 2012;Choi et al, 2012;Kazenwadel et al, 2012;Matsuo et al, 2007;Pepper et al, 1994;Shin et al, 2006). In addition, the use of high concentration of FGF2 in culture medium and FGF2 stimulation after starvation were associated with upregulation of pro-lymphangiogenic gene expression in LECs (Cao et suggested mechanism is that FGF2 might induce expression and secretion of lymphangiogenic factors other than FGF2 from smooth muscle cells, BECs and perivascular cells, and then stimulate lymphangiogenesis in an indirect fashion (Bruyère et al, 2008;Chang et al, 2004;Kubo et al, 2002).…”

“…We induced experimental lymphatic regeneration in the tails of mice, according to previously described procedures (Choi et al, 2012;Rutkowski et al, 2006). Briefly, we removed a circumferential 2-mmwide piece of skin located ,1 cm distal of the tail base, and severed the deeper lymphatics running alongside the major blood vessels.…”

Lymphatic regulator PROX1 determines Schlemm’s canal integrity and identity

“…Primary LECs were cultured under the static or laminar flow condition for 12 hours and immediately subjected to ChIP as previously described (64) using anti-Klf4 antibody or control IgG. Sequences for the primers used are as follows: primer set 1: GAGCCTCCCAT-TACTCAGACC; GAGGCTCCCGCTTAGAAACT; primer set 2: TTGTTCTTTTGAGCCCTGCCATGTGAGTTC; CCTCCACCTGCT GCCTAAAGT).…”