Stem rust (<i>Puccina graminis</i>) identified on spring barley in the UK adjacent to infected <i>Berberis vulgaris</i>

Orton, Elizabeth S.; Lewis, Clare M.; Davey, Phoebe; Radhakrishnan, Guru V.; Saunders, Diane G. O.

doi:10.5197/j.2044-0588.2019.040.011

Cited by 3 publications

(4 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…First, to confirm that the aecium collected in Kelso was P . graminis , DNA was extracted from a portion of the aecium using the DNeasy Plant Mini Kit (QIAGEN) and the internal transcribed spacer (ITS) region amplified using primers 5ITS (5′‐GGAAGTAAAAGTCGTAACAAGGT‐3′) and 3ITS (5′‐ACTCCTTGGTCCGTGTTTCA‐3′) (Orton et al, 2019). The resulting PCR product was purified using the Qiaquick PCR purification kit (QIAGEN) and sequenced (Genewiz).…”

Section: Methodsmentioning

confidence: 99%

“…(5′-ACTCCTTGGTCCGTGTTTCA-3′) (Orton et al, 2019). The resulting PCR product was purified using the Qiaquick PCR purification kit (QIAGEN) and sequenced (Genewiz).…”

Section: Itsmentioning

confidence: 99%

“…A total of 12 Pgt-infected wheat stem samples were collected across the five experimental plots in Ireland and, to enrich the representation of Pgt isolates from European countries in subsequent analyses, 11 additional Pgt-infected leaf and stem samples were collected in France in 2019 and 2020 (10 samples) and Italy in 2019 (one sample). We also collected four additional UK samples that included a sample from a single barley plant that displayed typical stem rust symptoms in summer 2019 (UK-05)(Orton et al, 2019), and three wheat samples (UK-02, UK-03 and UK-04) from plants subjected to controlled infections with spores derived from a single rust aecium identified on B. vulgaris. All aforementioned samples were subjected to transcriptome sequencing.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Wheat stem rust recorded for the first time in decades in Ireland

et al. 2022

View full text Add to dashboard Cite

Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici (Pgt), has threatened wheat and barley production throughout history (Peterson, 2001). Today, it is a principal biotic constraint in most major wheat-growing areas worldwide, with the potential emergence of new virulent strains that overcome varietal resistance a serious global concern (Gill et al., 2020). Such trepidation was substantiated by the appearance of the highly virulent Ug99 race (termed TTKSK) in Uganda in 1998, which dramatically changed the scale of epidemics, consigning 80% of the world's wheat varieties vulnerable to this one race (Singh et al., 2011). Since then, a number

show abstract

Section: Methodsmentioning

confidence: 99%

“…(5′-ACTCCTTGGTCCGTGTTTCA-3′) (Orton et al, 2019). The resulting PCR product was purified using the Qiaquick PCR purification kit (QIAGEN) and sequenced (Genewiz).…”

Section: Itsmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Wheat stem rust recorded for the first time in decades in Ireland

et al. 2022

View full text Add to dashboard Cite

show abstract

“…(b) Black stem rust telia (left) and orange uredinia (right) were identified on the stem of a barley plant in early August 2019. (c) Erumpent black telia full of teliospores on the stem of a late sown barley plant in the UK (Orton et al, 2019) F I G U R E 2 Berberis vulgaris is particularly susceptible to stem rust infection. (a, b) Illustrations of B. vulgaris, which produces yellow flowers in June and bears bright red drooping clusters of two-seeded berries in autumn.…”

mentioning

confidence: 99%

Banishing barberry: The history of Berberis vulgaris prevalence and wheat stem rust incidence across Britain

2020

View full text Add to dashboard Cite

Wheat stem rust, caused by the fungal pathogen Puccinia graminis f. sp. tritici (Pgt), is a notoriously damaging disease of wheat and barley (Figure 1). Today, stem rust occurs in most major wheat-growing regions worldwide, and western Europe is currently experiencing a resurgence in infections after many decades of absence (Lewis et al., 2018; Saunders et al., 2019). Stem rust has threatened crop production throughout history, with the earliest archaeological evidence of its spores having been identified close to the centre of the area where cereal cultivation first began, on Neolithic potsherds from

show abstract

Will yield gains be lost to disease?

Saunders

2021

Nat. Clim. Chang.

View full text Add to dashboard Cite

Stem rust (Puccina graminis) identified on spring barley in the UK adjacent to infected Berberis vulgaris

Cited by 3 publications

References 4 publications

Wheat stem rust recorded for the first time in decades in Ireland

Wheat stem rust recorded for the first time in decades in Ireland

Banishing barberry: The history of Berberis vulgaris prevalence and wheat stem rust incidence across Britain

Will yield gains be lost to disease?

Contact Info

Product

Resources

About