Real time polymerase chain reaction to diagnose Anaplasma marginale in cattle and deer (Ozotoceros bezoarticus leucogaster) of the Brazilian Pantanal

Abstract

<jats:p>Epizootiological study of Anaplasma marginale in regions that contain various reservoir hosts, co-existence of rickettsia pathogens, and common vectors is a complicated task. To achieve diagnosis of this rickettsia in cattle and campeiro deer of Brazilian Pantanal, a comparison was made between a real time polymerase chain reaction (RT-PCR) with intercalating Sybr Green fluorochrome and primers based on msp5 gene of A. marginale; a conventional PCR (C-PCR); and parasitological examination using thin blood smear stained with Giemsa-MayGrunwald. Both PCRs showed good performance in the diagnosis of A. marginale in cattle, and were superior to the parasitological exam. The RT-PCR detected seven positive campeiro deer (16.3%). This rate was significantly higher compared to C-PCR, which identified one animal as positive (2.3%), and also compared to parasitological diagnosis, which did not find any positive animals. The dissociation temperature average of positive reactions in cattle (81.72 ºC ± 0.20) was identical to dissociation temperature found in the cervids (81.72 ºC ± 0.12), suggesting that both animal species were infected with A. marginale. We concluded that RT-PCR can be used for A. marginale diagnosis and in epizootiological studies of cattle and cervids; in spite of the small number of campeiro deer samples, the results indicated that this wildlife species has importance in the Anaplasma epizootiology in the Brazilian Pantanal.</jats:p>

Molecular diagnosis of Anaplasma marginale in cattle: quantitative evaluation of a real-time PCR (Polymerase Chain Reaction) based on msp5 gene

“…On the other hand, due its relatively lower cost, end point PCR is a more suitable tool for epidemiological studies. However, the high sensitivity of real-time PCR may also be exploited in epidemiological studies, especially in wild ruminants, which usually present chronic infections with low levels of rickettsemia (Picoloto et al 2010), and are susceptible to infection by both A. marginale and A. ovis.…”

“…Real-time PCR was performed with Platinum SYBR Green/ROX (Invitrogen 5 ) in a final volume of 12.5μL, using the previously described (Picoloto et al, 2010) primer set msp5 AMTR F: 5' AAGGCGAGGAGCTGTTTAAG 3' and AMTR R: 5' CTACT-GCCTCACAAGGACGA 3'. Amplification was performed with a StepOne Plus thermocycler (Applied Biosystems 7 ) as follows: 50°C for 2 minutes, 95°C for 2 minutes, 40 cycles at 95°C for 30 seconds (denaturation) and 54°C for 15 seconds (annealing/extension).…”

Post-mortem hemoparasite detection in free-living Brazilian brown brocket deer (Mazama gouazoubira, Fischer 1814)

“…The prevalence of A. marginale infection in Brazilian cervids has been reported at different values, specifically 6.3% and 48% in O. bezoarticus from the Pantanal region according to Picoloto et al (2010) and Silveira et al (2013), respectively, and 79.3% in M. gouzoubira from Minas Gerais state according to Silveira et al (2012). However, the consequences of infection for deer health are not clearly understood.…”

“…have been described in wild cervids (Blastocerus dichotomus, Ozotoceros bezoarticus and M. gouazoubira) in Mato Grosso do Sul and Minas Gerais states (MACHADO et al, 2006;PICOLOTO et al, 2010;SACCHI et al, 2012;SILVEIRA et al, 2012SILVEIRA et al, , 2013.…”

Investigação molecular de Ehrlichia canis, Anaplasma platys, Anaplasma phagocytophilum e Rickettsia spp. em felídeos selvagens cativos

“…No Brasil, já foram encontradas as espécies A. platys, A. phagocytophilum, A. bovis (Sacchi et al 2012), A. marginale (Picoloto et al 2010), E. canis, E. chaffeensis e E. ewingii, todas tendo como vetor o carrapato (Vieira et al 2011). A espécie N. risticii, descrita infectando equinos no Rio Grande do Sul, tem como vetores trematódeos aquáticos (Coimbra et al 2006).…”