Comparison of predicted binders in Rhipicephalus (Boophilus) microplus intestine protein variants BM86 Campo Grande strain, BM86 and BM95

Abstract

Rev. Bras. Parasitol. Vet., 17, 1, 93-98 (2008) (Brazil. J. Vet. Parasitol.) RESUMOO objetivo deste estudo foi analisar a seqüência de Bm86 cepa Campo Grande comparando-a com os antígenos Bm86 e Bm95 das preparações TickGard PLUS e Gavac TM , respectivamente. O produto de PCR foi clonado em PMOSBlue e seqüenciado. Para calcular os conteúdos de alfa-hélice e fita beta do polipeptídio previsto, foi utilizada a ferramenta de prognóstico de estrutura secundária PSIPRED. O perfil de hidrofobicidade foi calculado usando os algoritmos de Hopp e Woods, além da identificação das possíveis regiões de ligação com MHC classe I nos antígenos. O alinhamento "pair-wise" revelou que a similaridade entre Bm86 cepa Campo Grande e Bm86 é 0,2% maior que aquela entre Bm86 cepa Campo Grande e Bm95. As identidades foram de 96,5% e 96,3%, respectivamente. Com relação à hidrofobicidade, os resultados sugerem que a maior diferença entre as seqüências está localizada em duas regiões específicas. PALAVRAS-CHAVE:Rhipicephalus (Boophilus) microplus, carrapato, Bm86, Bm95, antígeno. INTRODUCTIONTick control remains a serious problem for cattle farms in Brazil. Limited success is achieved when acaricides are used as the main control method, and major drawbacks are associated with development of resistance by ticks and chemical residue toxicity in the environment and animal products (GRISI et al., 2002). The use of vaccines for tick control in association with chemicals and pasture rotation may open possibilities for integrated control, reducing the problems caused by development of resistance by the parasites and environmental and food product contamination (GARCIA-GARCIA et al., 2000).An effective vaccine was developed based on the Rhipicephalus (Boophilus) microplus gut Bm86 antigen (KEMP et al., 1989; DE LA FUENTE et al., 1995 , respectively. The PCR product was cloned into pMOSBlue and sequenced. The secondary structure prediction tool PSIPRED was used to calculate alpha helices and beta strand contents of the predicted polypeptide. The hydrophobicity profile was calculated using the algorithms from the Hopp and Woods method, in addition to identification of potential MHC class-I binding regions in the antigens. Pair-wise alignment revealed that the similarity between Bm86 Campo Grande strain and Bm86 is 0.2% higher than that between Bm86 Campo Grande strain and Bm95 antigens. The identities were 96.5% and 96.3% respectively. Major suggestive differences in hydrophobicity were predicted among the sequences in two specific regions.

Bovine immunoprotection against Rhipicephalus (Boophilus) microplus with recombinant Bm86-Campo Grande antigen

“…(B.) microplus yielded 46.4% and 49.2% efficacy, respectively (ANDREOTTI, 2006). These results varied from those previously reported for both the anti-R.…”

“…The entire 1825-bp DNA fragment corresponding to Bm86-CG (GenBank accession no: EU352677.1) (ANDREOTTI et al, 2008) was amplified by PCR using primers BmCG-EcoRI-F1 (CGGAATTCTCATCCATTTGCTC) and BmCG-KpnI-R2 (TGGAAAGTCAAGTGCGGTACCCC) in a Mastercycler Personal thermal cycler (Eppendorf, Germany) using Platinum ® Taq DNA Polymerase High Fidelity and cloned into the pPICZαA vector (Invitrogen). Insertion was confirmed by subjecting plasmid to PCR with 5'AOX1 and 3'AOX1 primers that flank the multiple cloning site in this plasmid.…”

“…The other six animals served as the control group and were treated as per protocol except that they received 2 mL injections of adjuvant alone each time. The protocol of Andreotti (2006) was slightly modified so each animal was injected intramuscularly at 0, 2 and 4 weeks. Serum samples were taken from each animal before immunization and weekly thereafter.…”

“…microplus vaccine products in other parts of the world. The level of efficacy reported for vaccines containing a recombinant form of Bm86 varies according to, among other factors, the expression system used for vaccine production, characteristics of the tick population targeted, and host factors (DE LA FUENTE et al, 1999;PATARROYO et al, 2002;RAND et al, 1989;RODRÍGUEZ et al, 1995;SITTE et al, 2002;ANDREOTTI et al, 2008;PARIZI et al, 2009). It has been postulated that sequence variation in the bm86 locus is associated with low susceptibility of certain R.…”

“…It has been suggested that diversity greater than 3% in amino acid sequence between the recombinant antigen and native Bm86 protein in target tick populations results in vaccination inefficiencies . The similarity between deduced protein sequences for Bm86 from the Campo Grande strain and the recombinant antigen used in the commercial vaccines was 96.5% (ANDREOTTI et al, 2008). Thus, using the recombinant Bm86-Campo Grande (rBm86-CG) protein as antigen for immunization could yield greater vaccine efficacy against R.…”