Quinolone resistance and ornithine decarboxylation activity in lactose-negative &lt;italic&gt;Escherichia coli&lt;/italic&gt;

Gomig, Franciane; Galvão, Carolina Weigert; Freitas, Denis Leandro de; Labas, Larissa; Etto, Rafael Mazer; Esmerino, L. A.; Lima, Marcelo A.; Appel, Márcia Helena; Zanata, Sı́lvio M.; Steffens, Maria; Nader, Helena B.; Silveira, Rafael Bertoni da

doi:10.1590/s1517-838246320131291

Cited by 5 publications

(4 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Apart from tetrathionate respiration, the metabolic profile of EcoFA807‐17 differs from commensal strains of E. coli in several ways. It does not decarboxylate lysine or ornithine which are known virulence factors among Escherichia/Shigella genomospecies (Casalino et al, 2003; Gomig et al, 2015; Maurelli et al, 1998), although it demonstrates Indole production, a trait long known to be typical of E. coli but much less common with Shigella (Rezwan et al, 2004) and certain other members of Enterobacteriaceae. Its sugar utilization resembles Shigella in being unable to metabolize lactose, sucrose, and xylose (Taylor, 1965).…”

Section: Resultsmentioning

confidence: 99%

“…T A B L E 3 Biochemical phenotype of EcoFA807-17 compared with E. coli (ATCC 10536) et al, 2003;Gomig et al, 2015;Maurelli et al, 1998), although it demonstrates Indole production, a trait long known to be typical of E. coli but much less common with Shigella (Rezwan et al, 2004) and certain other members of Enterobacteriaceae. Its sugar utilization resembles Shigella in being unable to metabolize lactose, sucrose, and xylose (Taylor, 1965).…”

Section: Biochemical Phenotype and Antibiotic Resistance Profiles Of ...mentioning

confidence: 99%

See 1 more Smart Citation

The emergence of the tetrathionate reductase operon in the Escherichia coli/Shigella pan‐genome

et al. 2022

View full text Add to dashboard Cite

Escherichia coli pathogenic variants (pathovars) are generally characterized by defined virulence traits and are susceptible to the evolution of hybridized identities due to the considerable plasticity of the E. coli genome. We have isolated a strain from a purified diet intended for research animals that further demonstrates the ability of E. coli to acquire novel genetic elements leading potentially to emergent new pathovars. Utilizing next generation sequencing to obtain a whole genome profile, we report an atypical strain of E. coli, EcoFA807‐17, possessing a tetrathionate reductase (ttr) operon, which enables the utilization of tetrathionate as an electron acceptor, thus facilitating respiration in anaerobic environments such as the mammalian gut. The ttr operon is a potent virulence factor for several enteric pathogens, most prominently Salmonella enterica. However, the presence of chromosomally integrated tetrathionate reductase genes does not appear to have been previously reported in wild‐type E. coli or Shigella. Accordingly, it is possible that the appearance of this virulence factor may signal the evolution of new mechanisms of pathogenicity in E. coli and Shigella and may potentially alter the effectiveness of existing assays using tetrathionate reductase as a unique marker for the detection of Salmonella enterica.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Biochemical Phenotype and Antibiotic Resistance Profiles Of ...mentioning

confidence: 99%

The emergence of the tetrathionate reductase operon in the Escherichia coli/Shigella pan‐genome

et al. 2022

View full text Add to dashboard Cite

show abstract

“…Among the isolates harboring class 2 integron, only one contained a gene cassette comprising estX + sat2 + sat1. Previous studies have reported that the presence of gene cassettes associated with antimicrobial resistance indicates increased resistance rates (58,59) as well as increased potential for horizontal transfer (60).…”

Section: Discussionmentioning

confidence: 99%

Genetic characterization of third- or fourth-generation cephalosporin-resistant avian pathogenic Escherichia coli isolated from broilers

Kang

Lim²,

Lee³

2022

Front. Vet. Sci.

View full text Add to dashboard Cite

The third- or fourth-generation cephalosporins (3GC or 4 GC) are classified as “critically important antimicrobials for human medicine” by WHO, but resistance to these drugs is increasing rapidly in avian pathogenic E. coli (APEC). This study investigated the distribution and genetic characteristics of 3GC- or 4 GC-resistant APEC isolates from five major integrated broiler operations in Korea. The prevalence of 3GC- or 4GC-resistant APEC isolates in 1-week-old broilers was the highest in farms of operation C (53.3%); however, the highest prevalence of these isolates in 4-week-old broilers was the highest on the farms of operation A (60.0%), followed by operations E (50.0%) and C (35.7%). All 49 3GC- or 4GC-resistant APEC isolates had at least one β-lactamase-encoding gene. The most common β-lactamase-encoding genes was extended-spectrum β-lactamase gene, blaCTX−M−15, detected in 24 isolates (49.0%), followed by blaTEM−1 (32.7%). Sixteen isolates (32.7%) harbored class 1 integrons, and four isolates (8.2%) showed different gene cassette-arrangements. However, only 1 of 26 isolates harboring class 2 integrons carried a gene cassette. Furthermore, both CRISPR 1 and 2 arrays were detected in most isolates (36 isolates; 73.5%), followed by CRISPR 2 (18.4%) and CRISPR 1 (4.1%). Interestingly, CRISPR 2 was significantly more prevalent in multidrug resistant (MDR)-APEC isolates than in non-MDR APEC isolates, whereas CRISPR 3 and 4 were significantly more prevalent in non-MDR APEC isolates (each 11.1%; p < 0.05). None of the protospacers of CRISPR arrays were directly associated with antimicrobial resistance. Our findings indicate that the distribution and characteristics of 3GC or 4GC-resistant APEC isolates differed among the integrated broiler operations; moreover, improved management protocols are needed to control the horizontal transmission of 3GC or 4GC-resistant APEC isolates.

show abstract

“…The primers used for the amplification of parC gene are: ParC F: GTATGCGATGTCTGAACT and ParC: R TTCGGTGTAACGCATTGC for parC; whereas those used for the amplification of gyrA are: GyrA F: AAATCTGCCCGTGTCGTTGGT and GyrA R GCCATACCTACGGCGATACC. The amplification program involved initial denaturation at 95°C for 2 min followed by 35 cycle of 95°C 30 sec, 55.4°C 60 sec and 72°C 60 sec [21]. The PCR products were sent to Macrogen/ Korea for sequencing using Sanger method and after that were aligned with gene sequences from National Center for Biotechnological information (NCBI) (https://www.ncbi.nlm.nih.gov/) in order to inspect for mutations.…”

Section: Mussa and Al-mathkhurymentioning

confidence: 99%

Incidence of Ciprofloxacin-Resistant of Methicillin Resistant Staphylococcus aureus isolated from Iraqi patients

Mussa

Al-Mathkhury

2018

ijs

View full text Add to dashboard Cite

The resistance of Staphylococcus aureus to ciprofloxacin has complicated the problem of treating staphylococcal associated infections in which MRSA is the causative agent since ciprofloxacin was the drug of choice to treat such infections. Our study investigated the incidence of Ciprofloxacin resistant S. aureus isolates that were also methicillin resistant among Iraqi patients. The obtained bacterial isolates were tested for Ciprofloxacin resistance using agar dilution method and the sequence of gyrA and parC. The results revealed that about 8% of the isolated MRSA strains were Ciprofloxacin resistant and the resistance was due to mutation in gyrA rather than parC.

show abstract

Quinolone resistance and ornithine decarboxylation activity in lactose-negative <italic>Escherichia coli</italic>

Cited by 5 publications

References 32 publications

The emergence of the tetrathionate reductase operon in the Escherichia coli/Shigella pan‐genome

The emergence of the tetrathionate reductase operon in the Escherichia coli/Shigella pan‐genome

Genetic characterization of third- or fourth-generation cephalosporin-resistant avian pathogenic Escherichia coli isolated from broilers

Incidence of Ciprofloxacin-Resistant of Methicillin Resistant Staphylococcus aureus isolated from Iraqi patients

Contact Info

Product

Resources

About