DNA polymorphism and total protein in mutants of Metarhizium anisopliae var. Anisopliae (Metsch.) Sorokin strain E9

Freire, Laurineide Lopes de Carvalho; Costa, Ana Bolena Lima da; Góes, Larissa Brandão; Oliveira, Neiva Tinti de

doi:10.1590/s1517-83822001000200004

Cited by 7 publications

(5 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…(RAPD) (Fegan et al, 1993;Bidochka et al, 1994;Piatti et al, 1998;Freire, 2001;Jensen et al, 2001;Gaitan et al, 2002), simple sequences repeat (SSR or microsatellites) analysis (Kretzner et al, 2000;Enkerli et al, 2001Enkerli et al, , 2005 and internal transcribed spacer (ITS)-rDNA sequence RFLP analysis (Rakotonirainy et al, 1994;Buscot et al, 1996;Coates et al, 2002a). Even though they have different and complementary discriminatory power RAPD, SSR and RFLP analysis have been very effective in detecting genetic diversity in several species (Couteaudier et al, 1998;Glare and Inwood, 1998;Coates et al, 2002b;Enkerli et al, 2005).…”

Section: Introductionmentioning

confidence: 99%

Intraspecific differentiation of Chilean isolates of the entomopathogenic fungi Metarhizium anisopliae var. anisopliae as revealed by RAPD, SSR and ITS markers

et al. 2007

View full text Add to dashboard Cite

The genus Metarhizium consists of a diverse group of asexual entomopathogenic fungi, which have a wide geographical distribution. The Chilean National Agricultural Research Institute (Instituto de Investigaciones Agropecuarias - INIA, Quilamapu Chile) has collected about 350 isolates of Metarhizium anisopliae var. anisopliae from central and southern Chile. These isolates have been partially characterized using morphological traits such as conidia size and shape, colony color, growth pattern and the efficiency of the isolates in controlling specific pests. However, further characterization with molecular markers could detect differences in DNA which could help to better understand the genetic diversity and structure of Chilean populations of this fungus. We analyzed approximately 10% of the INIA collection (39 isolates selected at random) collected from different geographical origins using the polymerase chain reaction (PCR)-random amplified polymorphic DNA (RAPD) method, simple sequences repeat (SSR or microsatellites) analysis and the PCR-restriction fragment length polymorphism (RFLP) assay of internal transcribed spacer (ITS)-rDNA sequences. The RAPD data revealed high genetic diversity in this fungus and an average of 41% of similarity while SSR analysis detected 45.2% similarity and the ITS markers 70.2% similarity. For the three molecular markers, this diversity was not associated with the geographical origin of these isolates

show abstract

Section: Introductionmentioning

confidence: 99%

Intraspecific differentiation of Chilean isolates of the entomopathogenic fungi Metarhizium anisopliae var. anisopliae as revealed by RAPD, SSR and ITS markers

et al. 2007

View full text Add to dashboard Cite

show abstract

“…anisopliae, isolated from Deois flavopicta (Hemiptera:Cercopidae), obtained from a stock collection of the Department of Genetics and Evolution, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil. This strain is largely used in bioassays and genetic studies (9,11,20,23,32). The conidia used in these studies were producted on complete culture medium (CM) consisting of yeast extract, glucose, minerals, agar, and water, according to Alves et, 1998 (3).…”

Section: Strain Of M Anisopliaementioning

confidence: 99%

Bioassay assessment of metarhizium anisopliae (metchnikoff) sorokin (deuteromycota: hyphomycetes) against Oncometopia facialis (signoret) (hemiptera: cicadellidae)

Júnior¹,

Lacava²,

Messias³

et al. 2008

Braz. J. Microbiol.

View full text Add to dashboard Cite

Citrus Variegated Chlorosis (CVC) is an economically important, destructive disease in Brazil and is caused by Xylella fastidiosa and transmitted by sharpshooter insects. In this study, the efficacy of the fungus Metarhizium anisopliae in controlling the sharpshooter Oncometopia facialis was studied by bioassay conditions. In the bioassay, insects were sprayed with a suspension containing 5 X 10 7 conidia mL -1. Adults captured in the field were treated in groups of 10 in a total of 11 replications per treatment. Significant differences between the natural mortality and the mortality of insects treated with the fungus were observed 6 days after inoculations (P<0.05). These significant differences increased until 10 days after treatment. The fungus caused 87.1% mortality, with the LT50 varying from 5 to 6 days. The LC50 was 1.2 X 10 6 conidia mL -1 , varying from 7.7 X 10 5 to 2 X 10 6 conidia mL -1 . The results showed that the sharpshooter O. facialis was susceptible to the entomopathogenic action of M. anisopliae in controlled condition during bioassay.

show abstract

“…Techniques which use DNA probes to create restriction fragment length polymorphism (RFLP) fingerprints have been used to distinguish between species (Hegedus and Khachatourians, 1993a) or individual isolates (Hegedus and Khachatourians, 1993b), although direct DNA probing methods may not exhibit the desired degree of sensitivity required for detection under field conditions (Hegedus and Khachatourians, 1996b). Other methods based on the polymerase chain reaction (PCR), such as the random amplified polymorphic DNA (RAPD) method, also exhibit the ability to discriminate between entomopathogenic fungal isolates (Jensen et al, 2001;Freire et al, 2001;Alves et al, 2001;Urtz and Rice, 1997;Fungaro et al, 1996;Leal et al, 1994;Bidochka et al, 1994) but the use of random oligonucleotide primers in the design of these systems is not useful in the detection of fungi within environmental samples which can contain a significant amount of DNA from indigenous biotic materials.…”

Section: Introductionmentioning

confidence: 99%

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Destéfano

Messias

2004

Genet. Mol. Biol.

View full text Add to dashboard Cite

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S-ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E 9 , B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E 9 , B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

show abstract

DNA polymorphism and total protein in mutants of Metarhizium anisopliae var. Anisopliae (Metsch.) Sorokin strain E9

Cited by 7 publications

References 21 publications

Intraspecific differentiation of Chilean isolates of the entomopathogenic fungi Metarhizium anisopliae var. anisopliae as revealed by RAPD, SSR and ITS markers

Intraspecific differentiation of Chilean isolates of the entomopathogenic fungi Metarhizium anisopliae var. anisopliae as revealed by RAPD, SSR and ITS markers

Bioassay assessment of metarhizium anisopliae (metchnikoff) sorokin (deuteromycota: hyphomycetes) against Oncometopia facialis (signoret) (hemiptera: cicadellidae)

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Contact Info

Product

Resources

About