Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

Soares-Ramos, Juliana R.L.; Ramos, Humberto J.O.; Cruz, Leonardo M.; Chubatsu, Leda S.; Pedrosa, Fábio O.; Rigo, L. U.; Souza, Emanuel Maltempi de

doi:10.1590/s1415-47572003000400019

Cited by 14 publications

(7 citation statements)

References 30 publications

(22 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The purified PCR products were sequenced directly using the sequencing primers 27f (AGA GTT TGA TCC TGG CTC AG) (Furushita et al, 2003); 108r (CAG ATT CCC ACG CGT TAC GC) and 420r (TTA CAA CCC TAA GGC CTT C) (Leys et al, 2004); Amp2 (AAG GAG GTG ATC CAR CCG CA) (Wang et al, 1993); 16S1203f (GAG GTG GGG ATG ACG TCA AGT CCT C); and 16S1110r (TGC GCT CGT TGC GGG ACT TAA CC) (Soares-Ramos et al, 2003). The purified PCR products were sequenced directly using the sequencing primers 27f (AGA GTT TGA TCC TGG CTC AG) (Furushita et al, 2003); 108r (CAG ATT CCC ACG CGT TAC GC) and 420r (TTA CAA CCC TAA GGC CTT C) (Leys et al, 2004); Amp2 (AAG GAG GTG ATC CAR CCG CA) (Wang et al, 1993); 16S1203f (GAG GTG GGG ATG ACG TCA AGT CCT C); and 16S1110r (TGC GCT CGT TGC GGG ACT TAA CC) (Soares-Ramos et al, 2003).…”

Section: Sequencing and Phylogeny Of Nif H And 16s Rrna Gene Fragmentsmentioning

confidence: 99%

Occurrence and diversity of nitrogen-fixingSphingomonasbacteria associated with rice plants grown in Brazil

Videira

Simões‐Araújo

Rodrigues

et al. 2009

FEMS Microbiology Letters

View full text Add to dashboard Cite

So far, the occurrence of nitrogen-fixing Sphingomonas bacteria has been restricted to three strains of Sphingomonas azotifigens. In this work, a group of 46 Sphingomonas-like isolates, which originated from two rice varieties grown in two soils in Brazil, were characterized based on morphological, physiological and genetic analyses. The PCR genus specifically applied indicated that all 46 isolates belonged to the Sphingomonas genus and confirmed the results based on the yellow pigment of the colonies grown on potato agar medium and the BIOLOG data. It was also observed that 22 isolates are nitrogen-fixing bacteria as determined by the acetylene reduction method and confirmed by nifH gene detection. The genetic diversity based on the 16S rRNA analysis (amplified rDNA restriction analysis) showed that the isolates formed two distinct groups at a similarity value of 60%. Furthermore, five clusters at 60% similarity were observed with the 16S-23S intergenic space (ribosomal intergenic space analysis) analysis. Sequencing of the 16S rRNA gene and nifH fragments showed that most of the 22 nitrogen-fixing isolates formed clusters apart from that of the S. azotifigens. This is the first report on the occurrence of nitrogen-fixing Sphingomonas bacteria associated with rice grown in Brazil.

show abstract

Section: Sequencing and Phylogeny Of Nif H And 16s Rrna Gene Fragmentsmentioning

confidence: 99%

Occurrence and diversity of nitrogen-fixingSphingomonasbacteria associated with rice plants grown in Brazil

Videira

Simões‐Araújo

Rodrigues

et al. 2009

FEMS Microbiology Letters

View full text Add to dashboard Cite

show abstract

“…The extracts were used for DNA purification with the Ultra Clean Plant DNA kit (MO BIO Laboratories Inc., USA). The purified DNA was then used to amplify the 16S rRNA gene of endophytes by PCR with the primers 27f (AGAGTTTGATCC TGGCTCAG) and 16S805r (GACTACCAGGGTATCTAATCCTG) (Lane, 1991;Soares-Ramos et al, 2003), which yielded a fragment of 800 bp. The polymerase chain reaction (PCR) contained 1X PCR buffer (Invitrogen, USA), 1.5 mM MgCl 2 , 200 µM of each dNTP, 5 pmol of each primer and 1 U TaqDNA polymerase Platinum (Invitrogen).…”

Section: Methodsmentioning

confidence: 99%

Culture-independent analysis of endophytic bacterial communities associated with Brazilian sugarcane

Magnani

Cruz²,

Weber³

et al. 2013

Genet. Mol. Res.

View full text Add to dashboard Cite

ABSTRACT. Sugarcane is an economically important culture in Brazil. Endophytic bacteria live inside plants, and can provide many benefits to the plant host. We analyzed the bacterial diversity of sugarcane cultivar RB-72454 by cultivation-independent techniques. Total DNA from sugarcane stems from a commercial plantation located in Paraná State was extracted. Partial 16S rRNA genes were amplified and sequenced for library construction. Of 152 sequences obtained, 52% were similar to 16S rRNA from Pseudomonas sp, and 35.5% to Enterobacter sp. The genera Pantoea, Serratia, Citrobacter, and Klebsiella were also represented. The endophytic communities in these sugarcane samples were dominated by the families Enterobacteriaceae and Pseudomonadaceae (class Gammaproteobacteria).

show abstract

“…The purified PCR products were sequenced directly using the sequencing primers 27f (AGA GTT TGA TCC TGG CTC AG) (FURUSHITA et al, 2003); 108r (CAG ATT CCC ACG CGT TAC GC) and 420r (TTA CAA CCC TAA GGC CTT C) (LEYS et al, 2004); Amp2 (AAG GAG GTG ATC CAR CCG CA) (WANG et al, 1996); 16S1203f (GAG GTG GGG ATG ACG TCA AGT CCT C); and 16S1110r (TGC GCT CGT TGC GGG ACT TAA CC) (SOARES-RAMOS et al, 2003).…”

Section: Bacterial Identificationmentioning

confidence: 99%

Antifungal activity of Stenotrophomonas maltophilia in Stomoxys calcitranslarvae

Moraes

Videira

Bittencourt

et al. 2014

Rev. Bras. Parasitol. Vet.

View full text Add to dashboard Cite

The microbiota present in Stomoxys calcitrans larvae may assist their survival in contaminated environments through production of inhibitory substances. Bacteriological identification methods, the polymerase chain reaction (PCR) and scanning electron microscopy (SEM) were used to detect a bacterium naturally present in mucus and macerated S. calcitrans larvae. The antifungal activity was determined based on the results from disk diffusion tests on an artificial solid medium. The bacterium was identified as Stenotrophomonas maltophilia and presented antifungal activity against Beauveria bassiana sensu lato isolates CG 138, CG 228 and ESALQ 986. This result suggests that the larval microbiota is a factor that can compromise the use of B. bassiana s.l. fungus for biological control of S. calcitrans larvae.Keywords: Stenotrophomonas maltophilia, Stomoxys calcitrans, antifungal activity. ResumoA microbiota presente em larvas de Stomoxys calcitrans pode auxiliar na sua sobrevivência em ambientes contaminados, devido à produção de substâncias inibidoras. Métodos bacteriológicos de identificação, reação em cadeia da polimerase (PCR) e microscopia eletrônica de varredura (MEV) foram utilizados para detectar uma bactéria naturalmente presente no muco e macerado de larvas de S. calcitrans. A atividade antifúngica foi baseada nos resultados obtidos no teste de difusão em meio sólido artificial. A bactéria foi identificada como Stenotrophomonas maltophilia e apresentou atividade antifúngica contra os isolados CG 138, CG 228 e ESALQ 986 de Beauveria bassiana sensu lato. Estes resultados sugerem que a microbiota larval é um fator que pode comprometer o uso de B. bassiana s.l. no controle biológico de larvas de S. calcitrans.

show abstract

Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

Cited by 14 publications

References 30 publications

Occurrence and diversity of nitrogen-fixingSphingomonasbacteria associated with rice plants grown in Brazil

Occurrence and diversity of nitrogen-fixingSphingomonasbacteria associated with rice plants grown in Brazil

Culture-independent analysis of endophytic bacterial communities associated with Brazilian sugarcane

Antifungal activity of Stenotrophomonas maltophilia in Stomoxys calcitranslarvae

Contact Info

Product

Resources

About