Diagnosis of human rabies cases by polymerase chain reaction of neck-skin samples

Macedo, Carla Isabel; Carnieli, Pedro; Brandão, Paulo Eduardo; Rosa, Elizabeth Salbé Travassos da; Oliveira, Rafael de Novaes; Castilho, Juliana Galera; Medeiros, Rita; Machado, Rosangela Rocha; Oliveira, Rosely Cerqueira de; Carrieri, Maria Luíza; Kotait, Ivanete

doi:10.1590/s1413-86702006000500008

Cited by 29 publications

(20 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The collection of brain biopsy samples [6] should be discouraged for intra-vitam diagnosis and should be restricted to post-mortem diagnosis. Skin biopsies can also be used for the post-mortem diagnosis of rabies encephalitis to replace brain biopsy when the latter is not feasible (which is the case in most of enzootic areas in Asia and Africa where cerebral brain biopsies are rarely authorized by the patient's family) [3], [7]. Because the viral shedding in saliva, CSF, and urine is suggested to be intermittent, multiple different samples (e.g., skin, saliva, urine) must be collected and analyzed by molecular methods for an intra-vitam rabies diagnosis.…”

Section: A Key Step: Selection Of Biological Samplesmentioning

confidence: 99%

More Accurate Insight into the Incidence of Human Rabies in Developing Countries through Validated Laboratory Techniques

Dacheux

Wacharapluesadee²,

Hemachudha³

et al. 2010

PLoS Negl Trop Dis

View full text Add to dashboard Cite

Section: A Key Step: Selection Of Biological Samplesmentioning

confidence: 99%

More Accurate Insight into the Incidence of Human Rabies in Developing Countries through Validated Laboratory Techniques

Dacheux

Wacharapluesadee²,

Hemachudha³

et al. 2010

PLoS Negl Trop Dis

View full text Add to dashboard Cite

“…RT-PCR was carried out using the 21G sense ( ATG TA A C A C C TC TA C A ATG) a n d 3 0 4 a n t i s e n s e (TTGACGAAGATCTTGCTCAT) 7 primers and the protocol described by Macedo et al 8 .…”

Section: Direct Immunofluorescence and Mouse Inoculation Testmentioning

confidence: 99%

Genetic characterization of rabies virus isolated from bovines and equines between 2007 and 2008, in the States of São Paulo and Minas Gerais

Macedo¹,

Carnieli²,

Fahl³

et al. 2010

Rev. Soc. Bras. Med. Trop.

Self Cite

View full text Add to dashboard Cite

Introduction: Rabies is an acute disease of the central nervous system and is responsible for the deaths of thousands of humans, wild animals and livestock, particularly cattle, as well as causing major economic losses. This study describes the genetic characterization of rabies virus variants that circulate in Desmodus rotundus populations and are transmitted to herbivores. Methods: Fifty rabies virus isolates from bovines and equines in the States of São Paulo and Minas Gerais, Brazil, were genetically characterized and compared with sequences retrieved from GenBank. Results: Two clusters (I and II) with mean nucleotide identities of 99.1 and 97.6% were found. The first of these contained nearly all the samples analyzed. Lineages from other Brazilian states grouped in cluster II. Conclusions: Analysis of the amino acid sequences of the N proteins revealed the existence of genetic markers that may indicate possible variations between geographic regions, although the biologically active regions are conserved within the species over space and time.Key-words: Rabies virus. Desmodus rotundus. Genetic characterization. Nucleoprotein gene. Cattle. RESUMOIntrodução: A raiva é uma doença aguda do sistema nervoso central e é responsável por mortes de milhares de humanos, animais silvestres e animais de criação -especialmente bovinos -além de causar elevadas perdas econômicas. Este trabalho descreve a caracterização genética das variantes do vírus da raiva que circulam em populações de Desmodus rotundus e são transmitidas aos herbívoros. Métodos: Cinquenta isolados de vírus da raiva de bovinos e equinos provenientes dos Estados de São Paulo e Minas Gerais, Brasil, foram caracterizadas geneticamente e comparadas com sequências recuperadas do GenBank. Resultados: Dois clusters, I e II, apresentando identidades médias de nucleotídeos de 99,1 e 97,6%, foram obtidos, sendo o primeiro composto de quase a totalidade das amostras analisadas. Linhagens de outros estados do Brasil "clustered" no II. Conclusões: A análise das sequências de aminoácidos da proteína N revelou que existem marcadores genéticos que podem determinar uma possível regionalidade embora as regiões biologicamente ativas apresentem-se conservadas dentro das espécies ao longo do tempo e espaço.

show abstract

“…The present study describes the first human rabies case successfully diagnosed antemortem using molecular biology methods standardized by MACEDO et al (2006) 10 . The recent cases of rabies in Wisconsin, USA, and Recife, Brazil, in which patients survived when coma was induced and antiviral drugs were used, show that molecular methods are important tools for the early identification of human rabies and allow the Milwaukee 15 or Recife 12 protocols to be used.…”

Section: Discussionmentioning

confidence: 99%

“…Aliquots of a "Challenge Virus Standard" (CVS) strain of fixed virus and water were used as positive and negative controls, respectively. RT-PCR was carried out with sense primer 504 (5'-TATACT CGAATCATGATGAATGGAGGTCGACT -3') and antisense primer 304 (5'-TTGACGAAGATCTTGCTCAT-3') for antemortem diagnosis and sense primer 21G (5'-ATGTAACACCTCTACAATG-3') and antisense primer 304 (TTGACGAAGATCTTGCTCAT) for postmortem diagnosis as previously described by MACEDO et al (2006) 10 .…”

Section: Rt-pcrmentioning

confidence: 99%

Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil

Brito¹,

Chamone²,

Silva

et al. 2011

Rev. Inst. Med. trop. S. Paulo

Self Cite

View full text Add to dashboard Cite

SUMMARYThe Ministry of Health's National Human Rabies Control Program advocates pre-exposure prophylaxis (PEP) for professionals involved with animals that are at risk of contracting rabies. We report an antemortem and postmortem diagnosis of rabies in a veterinarian who became infected when handling herbivores with rabies. The antemortem diagnosis was carried out with a saliva sample and a biopsy of hair follicles using molecular biology techniques, while the postmortem diagnosis used a brain sample and conventional techniques. The veterinarian had collected samples to diagnose rabies in suspect herbivores (bovines and caprines) that were subsequently confirmed to be positive in laboratory tests. After onset of classic rabies symptoms, saliva and hair follicles were collected and used for antemortem diagnostic tests and found to be positive by RT-PCR. Genetic sequencing showed that the infection was caused by variant 3 (Desmodus rotundus), a finding confirmed by tests on the brain sample. It is essential that professionals who are at risk of infection by the rabies virus undergo pre-exposure prophylaxis. This study also confirms that molecular biology techniques were used successfully for antemortem diagnosis and therefore not only allow therapeutic methods to be developed, but also enable the source of infection in human rabies cases to be identified accurately and quickly.

show abstract

Diagnosis of human rabies cases by polymerase chain reaction of neck-skin samples

Cited by 29 publications

References 12 publications

More Accurate Insight into the Incidence of Human Rabies in Developing Countries through Validated Laboratory Techniques

More Accurate Insight into the Incidence of Human Rabies in Developing Countries through Validated Laboratory Techniques

Genetic characterization of rabies virus isolated from bovines and equines between 2007 and 2008, in the States of São Paulo and Minas Gerais

Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil

Contact Info

Product

Resources

About