A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

Abstract

Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV) frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV) and an antigenically identical but cytopathic virus (cpBVDV) can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98%) to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

Identification and characterization of 16 recent Chinese isolates of bovine viral diarrhea virus genotype 2 (BVDV-2)

“…BVDV of both genotypes may occur in cytopathogenic (CP) and non-cytopathogenic (NCP) forms, classified according to whether or not it produces visible change in cell cultures (Xue at al., 2010). Generally, the existence of insertions within the region coding for the NS2/3 is a sign of cp-BVDV (Baroth et al, 2000;Quadros et al, 2006;Becher et al, 2002). In order to confirm whether there were insertions in the 16 isolates or not, primers (Space-P2: GTTCATAATCATAGCAGTGGTCGCC; Space-P1: GTGGCAAGGTGGCAGGTTCTCT) were designed according to the NS2/3 genes in GenBank.…”

Genetic diversity of bovine diarrhea and mucosal disease virus

“…Otwarta ramka odczytu koduje około 4000 aminokwasów, z których po cięciu powstaje od 11 do 12 białek strukturalnych oraz niestrukturalnych. Do niestrukturalnych należą białka N pro , NS2-3 (NS2, NS3), NS4A, NS4B, NS5A, NS5B i p7 do strukturalnych białka C, E rns , E1, E2 [41]. N-końcowe białko (N pro ) jest autoproteazą cysteinową, która odcina samą siebie od kolejnego białka płaszcza (Core protein -C) oraz indukuje pro teasomalną degradację czynnika transkrypcyjnego interferonu β -IRF3 (Interferon regulatory factor 3) [5,14].…”

“…Niecytopatyczne (Non-cytopathic -ncp) szczepy BVDV kodują białko niestrukturalne NS2-3, natomiast u szczepów o biotypie cytopatycznym (Cytopathic -cp) białko to jest cięte na dwa odrębne białka: NS2 i NS3. Białko NS3 określane jest jako marker cytopatyczności, gdyż występuje wyłącznie u szczepów cytopatycznych wirusa BVD [41]. Niestrukturalne białko NS3 posiada aktywność proteazy serynowej.…”

“…Większość osobników chorych na MD pada w ciągu pierwszych 6-24 miesięcy życia. Wirusy cp i ncp izolowane od takich osobników są identyczne antygenowo i określane jako szczepy homologiczne [41].…”

Genomic sequencing and characterization of a Chinese isolate of Bovine viral diarrhea virus 2

“…BVDV of cytopathic (cpBVDV) and non-cytopathic type are distinguished by their effect on the cell culture (McClurkin et al, 1985;Baker, 1987). Cytopathic type of BVDV is correlated with the presence of insertions of cellular sequences, duplication of viral sequences with or without insertions, deletions, and point mutations in the genomes (Baroth et al, 2000;Becher et al, 2002;Quadros et al, 2006). Reported insertions in cpBVDV are distributed mainly at three positions including aa 1161, aa 1545, and aa 1589 at the area of NS2/3 genes (Ridpath et al, 2006).…”