Análise da diversidade genética de isolados de Xanthomonas axonopodis pv. malvacearum do algodoeiro

Nunes, Maria Paula; Mehta, Ângela; Aguiar, P. H.; Cia, Edivaldo; Pizzinato, Maria A.; Chiavegato, Ederaldo José; Mehta, Y. R.

doi:10.1590/s0100-54052009000200004

Cited by 3 publications

(3 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Studies carried out with isolates obtained from sugarcane plants with symptoms of leaf scald disease from Gabon, indicate greater aggressiveness than that observed in the isolates from Guadalupe and the USA [13], while in Mexico [9], amplified a band of 288 bp of four strains of X. albilineans obtained in Veracruz and Chiapas, of which two were more aggressive, but all presented 98% nucleotide identity with an isolate from Brazil.…”

Section: Discussionmentioning

confidence: 99%

“…The PCR was performed with the primers FGPS1490 (5'-TGC GGC TGG ATC ACC TCC TT-3 ') and FGPS132 (5'-CCG GGT TTC CCC ATT CGG-3'), which amplify a 620bp product, corresponding to the 16-23S rRNA region [13]. A PTC100 thermal cycler (MJ Research, USA) was used, with the following reaction program: one cycle at 94°C for 1 min; 40 cycles at 94°C for 30 s, a cycle at 65°C for 30 s and 72°C for 1 min and a final cycle at 72°C for 5 min.…”

Section: Molecular Detection and Studies Of Genetic Variabilitymentioning

confidence: 99%

See 1 more Smart Citation

<i>Xanthomonas albilineans</i> (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

Pérez¹,

Milian²,

Hechevarria³

et al. 2021

View full text Add to dashboard Cite

Four isolates of the phytopathogenic bacterium Xanthomonas albilineans (Xa) from samples taken in commercial fields of different Cuban provinces and two from the cultivar L55-5, artificially infected in the Camagüey and Matanzas Experimental Stations, were used for the extraction of total nucleic acids according to the CTAB protocol. They were amplified by PCR using four primer combinations: A: P1-M1, B: P1-M2, C: P2-M1 and D: P2-M2. Direct sequencing of the PCR products was performed on all samples and the nucleotide sequences were used to generate partial consensus of 16-23S rRNA, which were analyzed with the BLASTn program. In all the isolates evaluated, the presence of a common band at the height of 620 bp was visualized and the AFLP profile showed that there is homology when comparing the sequences corresponding to the 16-23S rDNA of X. albilineans of the different isolates; the phylogenetic analysis reflected a grouping of the isolates of the species, regardless of its geographical origin, different from others of the genus Xanthomonas. The comparison of the Cuban isolates with eight strains published in GenBank, showed marked similarity with them, with 100% nucleotide identity and percentage of coverage with a genome fragment of the GPE PC73 strain from Guadalupe, KO905 from the United States and a strain from Brazil. The predominance of the generalized circulation in Cuba of a single serovar is presumed.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Molecular Detection and Studies Of Genetic Variabilitymentioning

confidence: 99%

<i>Xanthomonas albilineans</i> (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

Pérez¹,

Milian²,

Hechevarria³

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Analysis of enterobacterial repetitive intergenic consensus (ERIC) and rep-PCR among 61 Brazilian isolates of Xcm revealed very narrow genetic variability among them with two groups based on the geographic region of isolation (Nunes et al 2009). In order to assess the global genetic diversity of Xcm including highly virulent strains (HVS), 38 strains from different countries were analyzed by rep-PCR with ERIC and BOX primer sets which revealed plentiful polymorphism of fingerprinting.…”

Section: Discussionmentioning

confidence: 99%

Characterization of Xanthomonas citri subsp. malvacearum strains in Iran

Razaghi¹,

Hasanzadeh²,

Ghasemi³

2012

Afr. J. Microbiol. Res.

View full text Add to dashboard Cite

Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host. Loss due to this disease was estimated for about 10 to 30% on Iranian native cultivars. During summer season, cotton leaves samples with typical bacterial blight symptoms were collected from cotton fields of Golestan province in 2004. Among different bacterial isolates, five distinct Xcm isolates were collected for further studies. Besides, 20 partially characterized Xcm strains were obtained from Iranian Plant Protection Organization for comparison purpose. Totally 25 strains were subcultured for further characterization based on morphological, biochemical, pathogenicity traits as well as genetic analyses. Among these, nine strains with distinct phenotypic characteristics were selected for complementary genetic studies. Sodium dodecyl sulphate -polyacrylamide gel electrophoresis (SDS-PAGE) protein analysis did not show any differences among strains in number and size of protein bands. In plasmid analysis, using alkaline lysis method, a single plasmid was detected for all examined isolates with molecular weight of 23 kb. Repetitive sequence based PCR (rep-PCR) fingerprinting assay using primer BOX AIR (5' CTACGGCAAGGCGACGCTGAC 3') also failed to differentiate the Iranian isolates. It was therefore concluded the strains might have the same origin.

show abstract

Documentation of virulence and races of Xanthomonas citri pv. malvacearum in India and its correlation with genetic diversity revealed by repetitive elements (REP, ERIC, and BOX) and ISSR markers

et al. 2018

View full text Add to dashboard Cite

Thirty-four Xanthomonas citri pv. malvacearum (Xcm) isolates collected from three cotton-growing zones of India were subjected for virulence and race documentation and further correlated with genetic diversity as revealed by repetitive elements [repetitive extragenic palindromic (REP), enterobacterial repetitive intergenic consensus (ERIC) and BOX elements] and intersimple sequence repeat (ISSR)-PCR analyses. Among the 34 isolates tested for virulence on susceptible cultivar LRA 5166, 7 were recorded as highly virulent (HV), 16 were moderately virulent (MV) and 11 were less virulent (LV). Eight different races were recorded by using ten cotton host differentials. Twenty-two isolates (65%) belonged to race 18. Twelve isolates (35%) pertained to races 3, 5, 6, 7, 8, 11 and 13. REP, ERIC, BOX, combined repetitive elements, and ISSR analyses revealed the presence of 7, 10, 9, 11, and 8 clusters, respectively, at similarity coefficient of 0.70 in dendrograms. Principal coordinate analysis (PCoA) exhibited 76.4% and 77.5% cumulative variability for combined repetitive elements and ISSR analyses. ERIC produced the highest polymorphic information content (PIC) value (0.928). A lot of intra-pathovar variability was observed in virulence and genomic fingerprinting among Xcm isolates. Many of the isolates grouped based on geographical origin irrespective of virulence or race. The spread of the pathogen races in India might be due to the transport of germplasm lines and seed materials from one place to others.

show abstract

Análise da diversidade genética de isolados de Xanthomonas axonopodis pv. malvacearum do algodoeiro

Cited by 3 publications

References 12 publications

<i>Xanthomonas albilineans</i> (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

<i>Xanthomonas albilineans</i> (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

Characterization of Xanthomonas citri subsp. malvacearum strains in Iran

Documentation of virulence and races of Xanthomonas citri pv. malvacearum in India and its correlation with genetic diversity revealed by repetitive elements (REP, ERIC, and BOX) and ISSR markers

Contact Info

Product

Resources

About

Análise da diversidade genética de isolados de Xanthomonas axonopodis pv. malvacearum do algodoeiro

Cited by 3 publications

References 12 publications

&lt;i&gt;Xanthomonas albilineans&lt;/i&gt; (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

&lt;i&gt;Xanthomonas albilineans&lt;/i&gt; (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

Characterization of Xanthomonas citri subsp. malvacearum strains in Iran

Documentation of virulence and races of Xanthomonas citri pv. malvacearum in India and its correlation with genetic diversity revealed by repetitive elements (REP, ERIC, and BOX) and ISSR markers

Contact Info

Product

Resources

About

<i>Xanthomonas albilineans</i> (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba

<i>Xanthomonas albilineans</i> (Ashby) Dowson: Study of Its Genetic Variability in Sugarcane Samples in Cuba