Сегодня малообъемная гидропоника как современный и экономически выгодный метод выращивания широко используется для производства овощных культур. Однако для успешного ведения культуры в условиях данной технологии необходимо иметь сорта и гибриды, адаптированные к специфическим условиям выращивания. Первым этапом селекционной работы, начатой нами в 2019 году, стала разработка модели гибрида томата для технологии «Фитопирамида», для уточнения параметров которой в 2019-2020 годах на многоярусных вегетационных трубных установках было проведено испытание 4 гибридов томата группы черри (F1Коралловые бусы, F1 Эльф, F1 Волшебная арфа, F1Лунный фонтан) и 2 гибридов томата группы коктейль (F1 Золотой поток, F1 Красный лукум) индетерминантного типа роста. Испытания проводили в 2019-2020 годах в поликарбонатной необогреваемой теплице «Фитопирамида» с частичной регуляцией параметров микроклимата (III световая зона). Температуру и относительную влажность воздуха регулировали путем проветривания, однако в жаркие солнечные дни температура воздуха в теплице поднималась до 30 °С. Посев томата в 2019 году проводили 5 апреля, высадку растений на установки – 29 апреля. В 2020 году посев проводили 15 апреля, высадку растений на установки – 8 мая. Растения формировали в 1 стебель, до трех кистей с удалением точки роста. Продолжительность нахождения растений на гидропонных установках в 2019 и 2020 годах составила 99 и 106 сут. соответственно. Полученные данные по раннеспелости, урожайности, продуктивности, товарности, поражению вершинной гнилью томата позволили уточнить параметры разрабатываемой модели гибрида. По результатам двух лет исследований все гибриды томата при выращивании на гидропонных установках вошли в группу раннеспелых (период «всходы – начало созревания» составил 65–79 сут.). На основании полученных результатов перспективными для выращивания по гидропонной технологии «Фитопирамида» представляются гибриды томата F1Коралловые бусы и F1 Золотой поток. Now low-volume hydroponics as a modern and cost-effective method of cultivation is widely used for the production of vegetable crops. However, it is necessary to have varieties and hybrids adapted to the specific growing conditions. In 2019 year selection work for creating hybrids for hydroponic technology “Fitopiramida” was started. The first stage of the breeding work, which we started in 2019, was the development of a tomato hybrid model for the «Fitopiramida» technology, to clarify the parameters of which in 2019-2020, 4 cherry tomato hybrids (F1 Corallovye busy, F1 Elf, F1Volshebnaya arfa, F1 Lunny fontan) and 2 cocktail tomato hybrids (F1Zolotoy potok, F1 Krasny lucum) of indeterminate growth type were tested on multi-tiered vegetation pipe installations. Researches were conducted in 2019-2020 in the polycarbonate unheated greenhouse «Fitopiramida» with partial regulation of microclimate parameters (III light zone). The temperature and relative humidity of the air were regulated by airing, but on hot Sunny days the temperature in the greenhouse rose to 30 °C. Tomato sowing in 2019 was carried out on April 5, and plants were planted on plants on April 29. In 2020, sowing was carried out on April 15, and planting on installations-on may 8. Plants were formed in 1 stalk, up to 3 brushes with the removal of the growth point. Duration of plants in hydroponic installations in 2019 and 2020 it was 99 and 106 days, respectively. Received data on earliness, yield, plant productivity, marketability, blossom-end rot damage allowed to clarify parameters of the hybrid model. For two-year researchers all tomato hybrids grown on hydroponic installations were included in the early ripening group (the period of «germination-beginning of ripening» was 65–79 days). Following the received results tomato hybrids F1 Korallovye busy and F1Zolotoy potok are considered perspective for hydroponic technology «Fitopiramida»
Relevance.Tomato hybrids of the "beef" type are a commodity group characterized by fruits whose mass exceeds 220-240 g. The fruits of this group are distinguished by an attractive aligned shape and color, large size and are in constant demand among consumers. In the assortment of supermarkets and markets, the share of "beef" tomatoes is 10-20% of the total volume. Methods.The results of studying the characteristics of tomato hybrids allowed us to identify the most valuable characteristics for selection in the selection of "beef" tomatoes. Traditionally, we select donor lines for the signs "fruit weight from 200 g and above", "high yield", "disease resistance". For hybrids of professional use, we also evaluate such characteristics as" fruit density", "high uniformity", "ability to form fruits with high uniformity and marketability throughout the growing season". For hybrids and varieties for the hobby market, the most important characteristics are "High taste qualities", "aroma", "high dry matter content". Results. As a result of selections based on these characteristics, such hybrids as Rumyani shar F1, Korallovy rif F1 (which are in demand not only in our country, but also in other countries), Katarina F1 were created.
Одно из самых опасных заболеваний томата – фузариозное увядание (Fusarium wilt), возбудитель которого – фитопатогенный гриб Fusarium oxysporum f. sp. lycopersici. Наиболее эффективный метод борьбы с этой болезнью – выращивание устойчивых сортов и гибридов томата. В настоящее время анализ растений по аллелям генов устойчивости успешно проводят с использованием молекулярных маркеров, которые позволяют выявить различия изучаемых образцов на уровне ДНК. Цель исследований – молекулярно-генетический анализ гибридов томата F1 селекции агрофирмы «Поиск» по устойчивости к фузариозу (ген I2). В качестве объекта исследования были взяты 17 гибридов томата F1 разных товарных групп (крупноплодные, кистевые, коктейль, черри). Исследования проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. Для идентификации аллелей гена I2использовали функциональный маркер I-2 c праймерами I-2/5F (CAAGGAACTGCGTCTGTCTG) и I-2/5R (ATGAGCAATTTGTGGCCAGT). ПЦР проводили в амплификаторе Termal Cycler Bio-Rad T 100, визуализацию результатов проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000. При идентификации гена устойчивости I2 к фузариозу у изучаемых гибридов томата F1 были выявлены фрагменты 633 п.н. (аллель I-2) и 566 п.н. (аллель I-2C), что указывает на их устойчивость к этому заболеванию. Установлено, что из 17 исследуемых гибридов 16 – устойчивы к фузариозу, из них 4 – доминантные гомозиготы по гену I2(аллели I-2). Гибрид F1 835/19 содержит в генотипе оба аллеля устойчивости: I-2 и I-2C. С целью проверки эффективности исследуемого гена I2 планируется оценка гибридов томата F1 методом искусственного заражения в фазе сеянцев (расы 1 и 2 Fusarium oxysporumf.sp. lycopersici). При подтверждении результатов маркерного анализа доминантные гомозиготы по гену I2 будут использованы в селекционном процессе для создания линий-доноров к фузариозу. One of the most dangerous diseases of tomato is fusarium wilt, caused by phytopathogenic fungus Fusarium oxysporum f. sp. lycopersici. The growing of tomato resistant varieties and hybrids is the most effective method to control this disease. Now plant analysis for alleles of resistance genes is successfully carried out using molecular markers that allow to identify differences in studied samples at DNA level. The aim of the research is a molecular genetic analysis of tomato F1 hybrids selected by the Poisk AgroFirm for resistance to fusarium wilt (gene I2). As an object of research, 17 hybrids of tomato F1 of different product groups (large-fruited, brush, cocktail, cherry) were taken. The analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. The functional marker I-2 with primers I-2/5F (CAAGGAACTGCGTCTGTCTG) and I-2/5R (ATGAGCAATTTGTGGCCAGT) was used to identify I2 gene alleles. The PCR was carried out in the Termal Cycler Bio-Rad T 100 amplifier, the results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer and were analyzed using the Gel Doc 2000 system. The fragments 633 bp (I-2allele) and 566 bp (I-2C allele) in investigated tomato hybrids indicate their resistance to this disease. Among 17 hybrids 16 are resistant to fusarium wilt, 4 hybrids from them are dominant homozygotes for I2 gene (I-2alleles). Hybrid F1 835/19 has both I-2 and I-2Calleles. To test the I2 gene effectiveness it is planned to assess tomato F1 hybrids by artificial inoculation in seedling phase (Fusarium oxysporum f. sp. lycopersici races 1 and 2). Dominant homozygotes for I2 gene will be used in breeding programs for creating donor lines of resistance to fusarium wilt if the results of marker analysis are confirmed.
В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.
Многоярусная вегетационная трубная установка (МВТУ) «Фитопирамида» – одна из перспективных технологий выращивания овощных культур, позволяющая существенно увеличить урожайность томата с единицы площади. Одна из уникальных возможностей, предоставляемых технологией «Фитопирамида», – получение большого урожая томатов в краткие сроки как за счет более раннего вступления в плодоношение, так и за счет высокой плотности посадки растений на установках. В связи с этим актуальна задача по созданию высокопродуктивных и конкурентоспособных гибридов томата с групповой устойчивостью к болезням, пригодных по морфобиологическим особенностям к возделыванию по данной технологии. В 2019–2021 годах авторами были разработаны селекционные модели гибридов томата групп черри и коктейль, крупноплодные и кистевые для технологии «Фитопирамида», в которых учтены специфические требования к гибридам томата. На основе разработанных моделей были подобраны методики оценки и отбора материала для селекционной работы. Для подтверждения гипотезы о возможности проведения части отборов в условиях технологии грунтовых теплиц при селекции для «Фитопирамиды» в 2021 году были проведены испытания 21 гибрида томата F1 индетерминантного типа роста (крупноплодные, кистевые, черри) в пленочной грунтовой теплице селекционного центра ВНИИО – филиала ФГБНУ ФНЦО и поликарбонатной теплице «Фитопирамида» с последующим корреляционным анализом данных. Был сделан вывод о возможности оценки индетерминантных гибридов томата в условиях пленочных грунтовых теплиц при селекции для технологии «Фитопирамида» по отдельным признакам: крупноплодные и кистевые гибриды – по средней массе одного плода (r = 0,72) и продолжительности периода «всходы – начало созревания» (r = 0,64), гибриды черри – по урожайности (r = 0,75) и средней массе одного плода (r = 0,95). Для наиболее достоверной оценки и точного отбора наиболее перспективных гибридов томата требуется их испытание на гидропонных установках. Tiered Vegetation Pipe Plant (TVPP) “Fitopiramida” is one of the advanced technologies for growing vegetable crops, which allows to significantly increase the yield of tomatoes per unit area. One of the unique opportunities provided by “Fitopiramida” technology is to obtain a large harvest of tomatoes in a short time both due to earlier ripening and high planting density on installations. For this reason breeding of highly productive and competitive tomato hybrids with group resistance to diseases, suitable for morpho-biological features for cultivation using this technology is actual task. In 2019–2021 the authors developed breeding models of cherry and cocktail tomato hybrids, large-fruited and brush tomato hybrids for “Fitopiramida” technology were developed, in which the specific requirements for tomato hybrids are taken into account. Based on the developed models, methods of material evaluation and selection for breeding work were chosen. To confirm the hypothesis about the possibility of carrying out part of the selections in the conditions of the ground greenhouses technology during breeding for “Fitopiramida”, in 2021 21 indeterminate tomato hybrids F1 (large-fruited, brush, cherry) were tested in the film ground greenhouse of the Selection Center ARRIVG – branch of FSBSI FSVC and in the polycarbonate greenhouse “Fitopiramida” with following correlation analysis of data. Based on the research results, it was concluded that it is possible to evaluate indeterminate tomato hybrids in conditions of film ground greenhouses during breeding for “Fitopiramida” technology by individual characteristics: large-fruited and brush hybrids – by the average weight of one fruit (r = 0.72) and the duration of the period “germination – beginning of ripening” (r = 0.64), cherry hybrids – by yield (r = 0.75) and average weight of one fruit (r = 0.95). For the most reliable assessment and accurate selection of the most promising tomato hybrids, their testing on hydroponic installations is required.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.